1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bumek [7]
3 years ago
7

I need some help with this question

Biology
1 answer:
Vaselesa [24]3 years ago
6 0

Answer:

i can't hardly see it

Explanation:

You might be interested in
Hasan is a three-year-old boy who lives in dhaka, bangladesh. He is small for his age, has bowed legs, exhibits muscle weakness,
marysya [2.9K]

Hasan most likely has rickets

Rickets is a disease of children which is caused by vitamin D deficiency. Rickets softens and weakens bones in affected children. Symptoms of rickets include bowed legs, pain in the bones, stunted growth, trouble sleeping and muscle weakness. Rickets can lead to other health problems such as intellectual disability and muscle spasms.

8 0
3 years ago
What are the 2 alleles for fur color in snurfles and which letters represent those alleles?
denis-greek [22]
The two alleles for fur color in snurfles are Yellow and Green. These alleles are represented by the letters G and g. Homozygous dominant GG is yellow, as well as heterozygous Gg. But recessive gg is green. These are the two colors that can be seen in the traits of fur colors in snurfles. I hope this helps.
4 0
3 years ago
The Hubble Telescope: has a 1,000 foot dish is the largest radio telescope in the world can receive near-infrared and ultraviole
Eduardwww [97]
<span>The answer is the Hubble telescope Can receive near-infrared ultraviolet wavelengths.</span>
7 0
3 years ago
Read 2 more answers
6. One parent cell divides into two identical daughter cells. What is the name of this process?
Afina-wow [57]

Answer: mitosis

Explanation:

Mitosis is the process when a parent cell is divided, and two daughter cells are found after the process. This question says that when the parent cell is split, two daughter cells are the result. This is mitosis, so the answer is D.

8 0
2 years ago
Assume that a base-pair substitution mutation converts a DNA triplet (AAT) to another DNA triplet (AAA). A second mutation now c
vagabundo [1.1K]

Answer:

The answer is "intragenic suppressor".

Explanation:

In this question, the second mutation on the inside of a mutated gene, that leads to both a simple restoration. Its second mutations were its instance of even a mutation suppresser because it contributed to both the evident recovery of its original phenotype from its second mutation within such a gene.

5 0
3 years ago
Other questions:
  • Which best describes the role of a secondary consumer in a food web?
    10·2 answers
  • Which organ systems are used to help the body shiver?
    14·2 answers
  • Which sentences describe the differences between photosynthesis and cellular respiration?
    7·2 answers
  • What role does catalase play in this reaction of anenzyme?
    12·1 answer
  • Which of the following was an early realization that gave rise to Darwin's theory of natural selection?
    14·2 answers
  • Dna replication makes a(n) ________ copy of the dna strand, while transcription makes a(n) ________ copy of the dna strand.
    6·1 answer
  • What is the term used for populations leaving an area?
    9·2 answers
  • What is the purpose of cell specialization in multicellular organisms?
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Explain why it would not be possible to accurately measure hemoglobin concentration if the RBCs were not first lysed
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!