1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inn [45]
4 years ago
8

PLS HELP ME UNDERSTAND THE CONCEPT

Biology
1 answer:
nexus9112 [7]4 years ago
6 0
Well all your doing is writing a paragraph about variation and pressures that can change the characteristics of population along with an example
You might be interested in
2. What is an investigation? What is a demonstration? How are the different?
saveliy_v [14]
An investigation is to search something up to look for the facts an demonstration is showing a reason of proof for something
3 0
3 years ago
Plant seeds use reserved nutrients to sprout. What organelle is converting the
mote1985 [20]

Answer:

The chloroplast

Explanation:

The choloroplast takes in nutriets (sunlight) and converts it into energy for the plant

7 0
3 years ago
Read 2 more answers
Tamiflu must be started within _______ hours of the onset of influenza symptoms
kow [346]
 Tamiflu® (oseltamivir<span> phosphate) </span>within<span> 48 </span>hours<span> of </span>flu onset<span> may help reduce the amount of time you are sick and help prevent the </span>flu<span>. Indications:</span>
3 0
3 years ago
The interface between the neural and endocrine systems is the _________________.
HACTEHA [7]

Answer:    Hypothalamus

Explanation:  The interface between the neural and endocrine systems is the hypothalamus, which through the pituitary gland controls the function of the peripheral endocrine glands. The hypothalamus, as a component of both the neural and endocrine systems, monitors the hormones secreted by the endocrine system, i.e. endocrine glands, to provide feedback that goes to the brain for processing. The pituitary gland, as one of the endocrine glands, is also controlled by the hypothalamus, meaning that the hypothalamus controls the secretion of hormones into the blood based on the needs determined by the processed brain data.

6 0
3 years ago
The automobile engine is the largest source of (blank) gas.
lubasha [3.4K]
I has to be d. Nitrogen Dioxide.
7 0
4 years ago
Read 2 more answers
Other questions:
  • The people of medieval Europe believed that absolute monarchy offered all of the following advantages EXCEPT:
    10·2 answers
  • Name 3 important features of blood in your body
    7·2 answers
  • All plants require nitrogen in forms they can absorb through their roots, and that accessible nitrogen is provided by certain so
    5·1 answer
  • Which describes a role of enzymes?
    6·2 answers
  • As a result of its involvement in a reaction, an enzyme _____.
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Cells a and f are an early And a late stage of the same phase of mitosis. What phase is it?
    14·1 answer
  • Imagine you are a detective examining a crime scene. You are trying to
    6·1 answer
  • See the Punnett square above. What are the chances these parents will have offspring with a homo-zygous recessive trait?
    5·1 answer
  • Explain the role of nitrogen and varbon dioxide in human beings.​
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!