The choices can be found elsewhere and as follows:
<span>a) mixture called a suspension
b) mixture called a solution
c) solution and suspension
d) mixture only.
</span>
I believe the answer is option B. If you stir salt into boiling water, you produce a mixture called a solution. Hope this answers the question. Have a nice day.
I believe the answer would be centrosome. not too sure but hope this helps. :)
Answer:
who is that ? and what are fruit flies ?
Explanation:
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: