1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
3 years ago
8

The word haunted appear as a motif in John Updike's "The Brown Chest," in what way and how does it contribute to the meaning of

the story?
Biology
1 answer:
Anettt [7]3 years ago
7 0
The choices are:
<span>A. The word haunted describes the boy’s ancestors. The word suggests their actions still affect him and influence his personality, even when he becomes an adult.
 
B. The word haunted describes items of antiquity. As a boy and as an adult, the narrator peers anxiously at old, unused items that make him feel uneasy.

C. The word haunted suggests that the boy is still haunted by memories of his childhood and his parents. The chest is a reminder of personal experiences he can’t ignore.

D. The word haunted describes the house the boy lived in. Even after he and his family moved to a new home, the memories of his fear stay with him.
</span>
The answer to your question is B. I hope this is the answer that you are looking for and it comes to your help.
You might be interested in
If you stir salt into boiling water, you produce a
jeka57 [31]
The choices can be found elsewhere and as follows:

<span>a) mixture called a suspension
b) mixture called a solution
c) solution and suspension
d) mixture only.
</span>
I believe the answer is option B. If you stir salt into boiling water, you produce a mixture called a solution. Hope this answers the question. Have a nice day.
6 0
3 years ago
What organelle is onlg found in abimal cells and onlg used during cell dision?
Evgen [1.6K]
I believe the answer would be centrosome. not too sure but hope this helps. :)
7 0
4 years ago
T.H Morgan worked with the tiny fruit flies known as​
kifflom [539]

Answer:

who is that ? and what are fruit flies ?

Explanation:

6 0
3 years ago
Grafting produces a plant that is a clone of the rootstock.<br> O True<br> O False
adoni [48]

Answer:

The answer is True.

8 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • DNA has unique properties that allow it to accurately retain genetic information, even after multiple rounds of replication. One
    12·1 answer
  • Desert-grassland boundaries can change as a result of _____.
    9·1 answer
  • What would you expect to find in all organisms?
    14·2 answers
  • Three characteristics or questions that can be used to classify governments
    6·1 answer
  • I am a human cell with 92 chromosomes. I still have a nuclear membrane. Where am I in the
    15·1 answer
  • What is substrate-level phosphorylation?
    6·1 answer
  • What is the relaishionship betwene genes and cromosomes
    8·1 answer
  • An organism in its early stages of development is called an
    5·2 answers
  • The amount of Earth covered by water might imply that all water is a renewable resource. Which statement best explains why not a
    9·2 answers
  • What factors may affect population growth ?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!