Answer:
Removal of plants, and invasive species.
Explanation:
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
E. Glaciers only scratch rocks that are located near the equator
Answer:
Twice.
Explanation:
If a soil with 3% moisture has twice the rate of erosion as compared to the soil having 7% moisture if both experience same speed of wind i. e. 15 m/s. This is because moisture held the particles of soil tightly with each other and prevent erosion in the soil so if the moisture becomes half in the soil then the rate of erosion is twice or doubled at constant wind speed.
Answer:
the uncontrolled growth of cells is known as cancer