1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rewona [7]
3 years ago
8

Help me on this please

Biology
1 answer:
Murljashka [212]3 years ago
3 0

Explanation:

A.

The transpiration stream that passes through a plant may follow an apoplastic route, with low resistance to flow, or a cell-to-cell route, in which cellular membranes impede water flow. However, passage of water through membranes can be facilitated by aquaporins thereby decreasing resistance. We investigated the relationship between transpiration, which can be down-regulated by abscisic acid (ABA) or by high humidity, and the osmotic water permeability (Pos) of protoplasts. By using leaf protoplasts of wild-type (wt) Arabidopsis thaliana plants and of mutants that are low in ABA (aba1) or insensitive to ABA (abi1 and abi2), we found that protoplasts from aba1 and abi mutants have very low Pos values compared with those from wt plants when the plants are grown at 45% relative humidity. High values of Pos were found 3 h after the addition of ABA to the culture medium of aba1 plants; addition of ABA to abi plants did not restore the Pos to wt levels. There was no such increase in Pos when excised leaves of aba1 plants were treated with ABA. When the transpiration stream was attenuated by growing the plants at 85% relative humidity, the Pos of protoplasts from all plants (wt and mutants) was higher. We suggest that attenuation of the transpiration stream in whole plants is required for the up-regulation of the Pos of the membranes, and that this up-regulation, which does not require ABA, is mediated by the activation of aquaporins in the plasma membrane.

B.

The influence of abscisic acid (ABA) on carbon metabolism, rate of photorespiration, and the activity of the photorespiratory enzymes ribulose bisphosphate oxygenase and glycolate oxidase in 7-day-old barley seedlings (Hordeum vulgare L. var. Alfa) was investigated. Plants treated with ABA had enhanced incorporation of labeled carbon from 14CO2 into glycolic acid, glycine, and serine, while 14C incorporation into 3-phosphoglyceric acid and sugarphosphate esters was depressed. Parallel with this effect, treated plants showed a rise in activity of RuBP oxygenase and glycolic acid oxidase. The rate of photorespiration was increased twofold by ABA treatment at molar while the CO2-compensation point increased 46% and stomatal resistance increased more than twofold over control plants.

You might be interested in
Unhealthy ecosystems are created by
Sloan [31]

Answer:

Removal of plants, and invasive species.

Explanation:

6 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
3 years ago
A glacier is a large, slow-moving mass of ice typically found far away from the Earth's equator. However, scientists have found
Tju [1.3M]
E. Glaciers only scratch rocks that are located near the equator
5 0
4 years ago
Read 2 more answers
How many times more erosion occurs in a soil with 3% moisture than a soil with 7% moisture is a 15 m s-1 wind?
max2010maxim [7]

Answer:

Twice.

Explanation:

If a soil with 3% moisture has twice the rate of erosion as compared to the soil having 7% moisture if both experience same speed of wind i. e. 15 m/s. This is because moisture held the particles of soil tightly with each other and prevent erosion in the soil so if the moisture becomes half in the soil then the rate of erosion is twice or doubled at constant wind speed.

6 0
3 years ago
Uncontrolled cell growth in a person's body can restrict the normal functioning of the surrounding cells. This
MArishka [77]

Answer:

the uncontrolled growth of cells is known as cancer

5 0
3 years ago
Other questions:
  • What are two ways to conserve water
    6·2 answers
  • Which of these sentences describes a benefit of fracking? A. Fracking provides jobs for people at well sites in the United State
    9·2 answers
  • How are the chemical equations of photosynthesis and cellular respiration related to each other?
    15·2 answers
  • The human appendix, a vestigial structure, is part of which structure.
    9·1 answer
  • If sound doesn’t travel or move, then what does when we hear something that originated on the other side of the room?
    11·1 answer
  • Hi I need help to answer this questions about punnett squares?
    14·1 answer
  • How enzymes inhibitions studies in the formulation and development of drugs​
    9·1 answer
  • Which of the following is NOT an example of radiant energy?
    15·2 answers
  • Heart and kidneys are called organs,why?​
    13·2 answers
  • In a certain species of cactus the cactus plant can be covered in Y shaped spines or X shaped spines. When crossing a cactus wit
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!