1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin [286]
3 years ago
9

Consider the table comparing amphibians and reptiles. Reptiles evolved

Biology
1 answer:
bazaltina [42]3 years ago
8 0

Answer:

1) Amphibians have smooth and moist skin while reptiles have dry and scales are present on their skin.

2) Amphibians lay eggs which are very soft so they are covered with a jelly like substance while reptiles also lays egg whose outer covering is tough.

3) Amphibians lays egg in the water while reptiles lays egg on the land.

Examples of amphibians are frog and salamander and examples of reptiles are snake and alligator.

You might be interested in
Organisms use a diversity of methods to obtain proper nutrition.
solniwko [45]

The ileum has <span>plicae circulares</span>, villi and microvilli, that are folds and projections of the mucosa layer of the ileum, that increase the surface area of food absorption.  The mucosa and the submucosa of the stomach have inner folds called rugae that increase the surface areas in which food is digested by enzymes.

Plants have root hairs in their tap roots that also increase the surface area for which they absorb water and nutrient from the soil. Fibrous roots have a mesh-like a network that also increases the surface area for increased absorption.






6 0
4 years ago
The enzyme which cuts down the viral dna with no harm to bacterial chromosme is
nalin [4]
Bacteria and restriction enzymes

,use enzymes to cut (and thereby destroy) foreign DNA (such as viral DNA), which would restrict the growth of the virus; own DNA is protected in some way (often by addition of methyl group CH3) to the sequence recognized by enzyme (thus preventing enzyme from binding there)

8 1
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
If a DNA molecule is 22% adenine in any organism, which percentage of thymine will that DNA molecule contain?
Inessa [10]

Answer:

22% thymine

Explanation:

adenine is paired with thymine meaning there will be equal amounts.

7 0
3 years ago
The Ring of Fire is a string of volcanic sites in the Pacific Ocean that stretches between the Americas, Asia, and Australia. Wh
Nastasia [14]

Answer:

Explanation:a

4 0
3 years ago
Other questions:
  • Pollution that runs off the land often combines with sediments at the bottoms of bodies of water. In this way, fish may become p
    15·1 answer
  • A stable pond ecosystem would not contain
    13·1 answer
  • If the surface area of a cell that is shaped like a cube increases 100 times, its volume increases about (1 point).
    14·2 answers
  • if merpeople have tail color alleles B (blue) and G (green) that follow the codominance inheritance rule, what are possible geno
    7·1 answer
  • Which statement best describes the relationship between photosynthesis and cellular respiration
    5·1 answer
  • How would you define energy How would you define energy and why do living things need energy
    14·2 answers
  • The energy in a sugar molecule is released through what
    10·1 answer
  • In the process of photosynthesis, light energy is used to split water into hydrogen and oxygen. The hydrogen combines
    13·1 answer
  • What type of charge does each atomic particle have?<br> Proton<br> Neutron<br> Election)
    11·1 answer
  • HELP!!!! Due in 1 hour.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!