All categories

2 years ago

What are the characteristics of a compound microscope?

Biology

1 answer:

pickupchik [31]2 years ago

5 0

<h2>Answer: The characteristics of a compound microscope is ...</h2>

Explanation:

The compound microscope consisting two type of lens.
The lens which is near the object, we call it objective lens. the lens which is near the eyes, we call it eye piece.
The lenses are fitted at the end of the metal tube .
The object to be magnified is placed just outside the principal focus of the objective so that its real image is formed on the other side of objective.
The position of the eye piece is so adjusted to form the final image at the near point .
The final image is virtual ,inverted and magnified .

You might be interested in

While we are sleeping, we can still perceive sounds and touch. this means that our bodies keep parts of the _____________ subdiv

Olin [163]

sensory somatic and peripheral, good luck!

8 0

3 years ago

Read 2 more answers

Describe three functions of hair

mote1985 [20]

Im not sure if this will be the answer you teacher is looking for but i think the answer would be

Hair on the head protects scalp from injury and sunlight

Eyelashes and eyebrows protect eyes

Nostril and ear hairs protect from foreign particles

6 0

2 years ago

1. Muscles move tendons attached to bone by performing an action called _______.

REY [17]

1. Contraction

2. Actin

3. Tendons

4. Epidermis

5. Dermis

6. Acne

7. A nerve signal from the brain arrives at the intersection of the nerve and muscle cells and releases acetylcholine from the neuron. This triggers chemical changes in the muscle cell involving ions, including Ca2+. Calcium triggers the thick filaments, made of myosin, to attach to the thin filaments, made of actin, in the muscle cell, and the myosin pulls the actin toward the center of the muscle cell. ATP causes the release of the actin fibers, allowing the muscle to relax and the process to begin again.

For Penn Foster.

5 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago

Which of Earth's layers is formed by volcanic activity?

mojhsa [17]

I believe it is the crust

5 0

2 years ago