1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad [161]
2 years ago
9

What is one function of plant stems?​

Biology
2 answers:
ozzi2 years ago
8 0

Answer:

The primary function of the stem

Explanation:

The primary function of the stem are to support the leaves;to conduct water and minerals to the leaves, where they can be converted into usable products by photosynthesis;and to transport these products from the leaves to other parts of the plant, including the roots

iren [92.7K]2 years ago
3 0
To conduct water and minerals to the leaves
You might be interested in
What are the functions of lipids?
OverLord2011 [107]
Quackity being blad
8 0
2 years ago
When you look at the Sun through a filtered telescope, you notice a blotchy appearance.
e-lub [12.9K]
The part of the Sun that you are observing when you see a blotchy appearance is the surface of the sun. This appearance is called granulation which is caused by the convection of the hot material inside the sun which go up and down the surface of the sun. Because of its sandy texture it is sometimes called lemon peel or rice grain.
3 0
3 years ago
Read 2 more answers
Differentiated cells in a multicellular organism tend to behave differently from stem cells. The process of differentiation alte
anzhelika [568]

Given what we know, we can confirm that the process of differentiation alters the cells by changing the expression of genes in a cell.

<h3>What is differentiation?</h3>
  • differentiation is when a cell becomes specialized.
  • This is the case with heart or digestive cells.
  • Since all cells carry the same DNA, this does not account for differentiation.
  • Instead, this is achieved by changing the expression of genes in a cell.

Therefore, we can confirm that differentiation is what we refer to as a cell becoming specialized in one way or function, such is the case with heart cells or digestive cells, and since all cells in the body carry the same DNA, this is done by changing the way in which the cells express their genes in the DNA.

To learn more about differentiation visit:
brainly.com/question/6977275?referrer=searchResults

8 0
2 years ago
Please no links or files or I will report
sattari [20]

Answer:

C

Explanation:

The moon revovles around the sun. While the moon goes around the earth, some half of the moon will be lighted up by the sun. The other side will always be in darkness. Hope this helps :)

6 0
2 years ago
Read 2 more answers
What type of intercellular junction bands together adjacent cells, making the epidermis stronger?.
fenix001 [56]

Answer:

Tight or occluding junctions This type of junction is also called zonula occludens and is the most apical structure in the epithelial cell. Zonula occludens describes, that there is a formed band of tight junctions which encircles every cell.

Explanation:

8 0
1 year ago
Other questions:
  • Which substance is an inorganic molecule?<br> A) starch B) DNA C) water D) fat
    11·2 answers
  • A protein is made and inserted into the membrane of the rough endoplasmic reticulum. A binding site that is present in this prot
    8·1 answer
  • The genome of an organism is its total genetic material. What aspects of the genome can and cannot be determined through karyoty
    12·1 answer
  • What can you conclude about fossil by looking at the layers of rock?
    9·2 answers
  • Compare the properties of a raw egg to those of a boiled egg.
    11·1 answer
  • When comparing prophase I of meiosis with prophase of mitosis, which of the following occurs only in meiosis?
    5·1 answer
  • Which statement may explain why the entire cell may not he<br> digested
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • I need help PLEASE and will give BRAINLY to ANYONE who answers ALL of the questions CORECTLYYYY!!!
    8·2 answers
  • (c) Wheat is another member of the grass family. Wheat grain is used to produce flour.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!