1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makvit [3.9K]
3 years ago
5

A water strider is an arachnid that can walk on the surface of water. This ability is due to water’s __________________. cohesio

n high specific heat ability to dissolve many substances neutral pH
Biology
1 answer:
max2010maxim [7]3 years ago
7 0
Should be "Surface tension" :))
You might be interested in
Benda yang dapat memancarkan cahaya
Lady bird [3.3K]
<span>karena matahari dapat memancarkan cahayanya sendiri.</span>
3 0
4 years ago
In your textbook, read about nucleotides.
lisabon 2012 [21]

Answer:

1. phosphate

2.sugar

3.purin bases

4.guanine

5.pyrimidine

6.cytosine

7 0
3 years ago
How did Mahler alter the original version of the tune for his symphony?
shutvik [7]

Mahler alter the original version of the tune for his symphony - Both answers are correct - put it in a minor key AND added more pitches to the melody.

<h3>Mahler alter the original version of the tune for his symphony ; </h3>

Gustav Mahler's Symphony No. 1 in D major was primarily written between late 1887 and March 1888, while it contains music Mahler had written for earlier works. While Mahler was as second conductor at the Leipzig Opera in Germany, it was written. Mahler almost always referred to the piece as a symphony in his correspondence, but its first two performances were referred to as symphonic poems and tone poems in symphonic form, respectively. The piece's premiere took place in 1889 in Budapest's Vigadó Concert Hall, but it got poor reviews. For the second performance, which was given in Hamburg in October 1893, Mahler made some significant changes. Subsequent changes were made in the years before the first publishing, which happened in late 1898.

To know more about Mahler alter please click here : brainly.com/question/24940876

#SPJ9

7 0
1 year ago
Write down General Characteristics of FROG ?? Plz Help Me In Detail For Class 9
Rainbow [258]

Answer:

Explanation:

In general, frogs have protruding eyes, no tail, and strong, webbed hind feet that are adapted for leaping and swimming. They also possess smooth, moist skins. Many are predominantly aquatic, but some live on land, in burrows, or in trees.

7 0
3 years ago
Read 2 more answers
TRUE OR FALSE?<br><br> Only eukaryotic cells have ribosomes.
IrinaK [193]
False
But eukaryotic cells that specialize in producing protein tend to have greater number of protein
3 0
3 years ago
Other questions:
  • ​lipids differ in their degree of saturation or unsaturation due to their number of ____.
    5·2 answers
  • Which type of selection on a polygenic trait increases variation in the trait
    8·1 answer
  • In order to produce vinegar, Acetobacter strains are used: they metabolize wine ethanol to acetic acid that gives vinegar its so
    8·1 answer
  • Snow is a type of weather<br> True<br> False
    11·1 answer
  • What is ozone at ground level.
    7·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • 1. Explain why species that overlap a great deal in their fundamental niches have a high probability of competing. Now explain w
    10·1 answer
  • What's a normal blood pressure range?
    8·1 answer
  • Which two types of stars will enter the supernova phase?
    12·1 answer
  • Can someone help pls
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!