1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ale4655 [162]
3 years ago
15

Which accurately describes the relationship between cancer risk and exposure to mutagens?

Biology
2 answers:
Vinvika [58]3 years ago
6 0
The answer is BBBBBBBBBBBBBB
yawa3891 [41]3 years ago
3 0
Cancer risk increases when a person is exposed to mutagens because the risk of DNA mutations increases as well.
You might be interested in
The third layer of the eye, the (1) , receives light rays and images and passes them on to the (2) nerve.
stepladder [879]
1. The third layer of the eye is the Retina 2. The retina <span>receives light rays and images and passes them on to the Optic nerve.</span>
6 0
3 years ago
Read 2 more answers
I need the CORRECT answer, quick!! Thank you, i will give brainliest.​
Ahat [919]

Answer:   A

Explanation:

Carrying Capacity because it is showing how many ferns the rainforest can support.

7 0
3 years ago
En que se diferencia el transporte en masa del transporte mediado por bombas​
Drupady [299]

Answer:

dontknobecauseitsnotenglish

Explanation:

i pefer english

8 0
3 years ago
Please help me. the first person to answer correctly will get a brainlist
iragen [17]
NSF international because it’s the public health and safety organization
3 0
3 years ago
Read 2 more answers
The _______________ is the brain structure involved in the storage of new information in memory.
MrRissso [65]
The nervous system
is the aswer
4 0
3 years ago
Other questions:
  • Place the living systems in order from smallest to largest based on hierarchical organization.
    9·1 answer
  • Plz help......................​
    10·1 answer
  • What layer forms the largest portion of the earth
    14·1 answer
  • On Earth, most years are 365 days long. On Saturn, a year is 10,740 days long. Why is a year on Saturn so much longer than a yea
    5·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Someone who suddenly loses the ability to identify objects by feeling them has probably suffered damage to what area of the cere
    9·1 answer
  • If the length of a helper t-cell is 20 micrometers calculate the approximate size of a HIV virus
    9·1 answer
  • Why is carbon called the building block of life?
    6·2 answers
  • Please answer ASAP
    15·1 answer
  • Reason each option and dont be stoopid.​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!