1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio039 [100]
3 years ago
5

What is the study of the distribution of plants and animals called?

Biology
1 answer:
Liula [17]3 years ago
5 0

The answer is:  " biogeography " .

_______________________________

Hope this helps!

Best wishes within your academic endeavors —

     and within the "Brainly" community!

______________________________

You might be interested in
Is the Earth dying? if so answer, and put the reason's why Earth is dying and what we can do to help Earth stop dying.
GenaCL600 [577]

Answer:

Earth has been our place for many years. all inhabitants on earth are causing great destruction. along the way we tried to resolve issues yet some we couldn't figure out. the one we couldn't figure out had made a great impact on our world today. Just how do we stop it? Many ways actually, taking pollution for example. pollution is a great cause for why earth isn't as lively as before. along the years we've polluted 92% of the earths air. causing us to breathe unhealthy air. We can easily fix this problem with finding new ways to get somewhere like riding a bike or taking an energy efficient car. Therefore, we humans have change the world dramatically by doing good things and bad things, too. but in the end we are the ones causing earth to nearly give up, so we can also be the ones to let the earth forgive.

hope this helps you out!

TIP: change it up so you don't do plagiarism:)

 

3 0
3 years ago
Ethanol produced from bioenergy starts with ________ produced by ________.
k0ka [10]
Ethanol produced from bioenergy starts with starch produced by corn and sugar cane :)
8 0
3 years ago
List 3 examples of physical traits affected by the environment
Sladkaya [172]
Muscle, hair color, height are the 3 most common physical traits affected by the environment.
5 0
3 years ago
Which of the following is a density-dependent factor?
sertanlavr [38]

Answer:

A

Explanation:

4 0
3 years ago
How do u explain the fact that the alcohol turns green?
Dmitrij [34]
Alcohol is a solvent and it basically dissolves anything. A lead is spongy and full of holes. When the leaf is mixed with alcohol, the alcohol affects the leaves. The alcohol melts the pigments of the leaf, chlorophyll, which is the green part. This will turn the alcohol green
6 0
3 years ago
Other questions:
  • How can a change in technology affect scientific knowledge?
    8·1 answer
  • A mudflow consists of debris with a large amount of
    12·1 answer
  • Which method is best for preventing further soil erosion in an area overgrazed by cows
    5·1 answer
  • The only “natural” taxa in Linnaeus’s system is the
    10·1 answer
  • Using EEGs, researchers try to identify __________ while subjects are engaged in different tasks. A. brain patterns B. mental ca
    11·1 answer
  • After hydrogen and oxygen, witch element makes up almost all of the most common substance in your body
    14·2 answers
  • ​untreated gastroesophageal reflux increases the risk for the more serious condition known as ____.
    15·1 answer
  • Describe biodiversity in various places on earth
    10·2 answers
  • Organisms are often classified by the relationships they have with other organisms in an ecosystem. A relationship in which both
    10·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!