1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Umnica [9.8K]
3 years ago
15

Consider an advantageous allele segregating in a population as a major polymorphism. Which of the following would not generally

slow the fixation of the allele?
a. The environment changes in such a manner as to reduce the selective advantage.
b. The population begins to receive immigrants from a population that maintains the same initial frequency of the alleles.
c. In addition to being advantageous the allele also exhibits overdominance.
d. The population begins to exhibit positive assortative mating for each of the genotypes.
e. The population size increases.
Biology
1 answer:
satela [25.4K]3 years ago
8 0

Answer:

C. In addition to being advantageous the allele also exhibits overdominance.

Explanation:

If the allele is advantageous and dominant over the other alleles, the individuals who own it will adapt better to the environment and most of their offspring will exhibit the attributes granted by the allele, which would increase its frequency in the population over time. In addition, individuals who own it will be more successful and more likely to reproduce than those who do not.

You might be interested in
A person's thyroid does not work correctly. What problem would he most likely have?
ehidna [41]
The person would have a problem with his metabolism.<span />
3 0
3 years ago
Read 2 more answers
How does predation affect population cycles
creativ13 [48]

Answer:

They grow more slowly, reproduce less, and populations decline.

Explanation:

brainliest plzzzzzzzzzzzzzzzzzzzzzzz

3 0
3 years ago
Name five (5) functions of the female reproductive system.
mars1129 [50]
<span>ovaries
</span><span>fallopian tube
</span>cervix
vagina
uterus
6 0
3 years ago
Daren has sickle-cell disease. Because of the disease, some of Daren's blood cells are long and thin instead of being disk-shape
neonofarm [45]

Answer: B cells can be influenced by genetic factors

Explanation: Daren has sickle cell disease. Sickle cell disorder is a kind of disease that affects the hemoglobin in the red blood cells. Hemoglobin, is a molecule in red blood cells that delivers oxygen to cells throughout the body. People with Sickle cell disorder have hemoglobin molecules called hemoglobin S, which distort the shape of the red blood cells. A normal red blood cell has a disc shape but people with sickle cell like Daren have their red blood cells and distorted into a sickle, or crescent, shape

5 0
3 years ago
A scientist is studying a plant species in which the flower color genes are codominant the scientist crosses a plant with red fl
strojnjashka [21]
In co dominance, both alleles show. Thus, the filial, F1, generation, will most likely be white with red spots/speckles. See image below.

6 0
3 years ago
Other questions:
  • The fact that individuals who possess favorable traits are more likely to survive and reproduce than those who possess less favo
    5·1 answer
  • Name the 1st stage of interphase &amp;tell what happens to the cell
    15·1 answer
  • Using the s-p timing method, epicenters can be located using seismograms from a minimum of ______ recording stations.
    14·1 answer
  • For the dilation, DO, K = (10, 0) → (5, 0), the scale factor is equal to _____.
    14·1 answer
  • When you exercise or work hard, your body requires more _____ and _____.
    6·1 answer
  • Why can't nerve cell go through cell division?​
    15·2 answers
  • The northern elephant seal was hunted almost to extinction during the 18th and 19th centuries. Less than 100 seals were left to
    13·1 answer
  • How would a large increase in the salinity of an estuary most likely affect
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • The monarch butterfly stores a poisonous
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!