1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alex41 [277]
2 years ago
12

What happens to the large amount of energy at each level as of the food chain​

Biology
1 answer:
Butoxors [25]2 years ago
7 0

Answer:

Energy decreases as it moves up trophic levels because energy is lost as metabolic heat when the organisms from one trophic level are consumed by organisms from the next level. ... A food chain can usually sustain no more than six energy transfers before all the energy is used up.

Explanation:

You might be interested in
10. Why are gene differences so important among members of a population ?
Stolb23 [73]
Gene differences are so important among the population because they the distinctivnes of people
3 0
3 years ago
Read 2 more answers
In which two ways can scientists exhibit ethical behavior?
alexdok [17]
Number 5 would be the best awnser.
As a scientist who remains impartial can more accurately conclude his data while doing experiments.
3 0
3 years ago
Read 2 more answers
Does the PLANT CELL have a CYTOSKELETON?<br> A. Yes<br> B. No
frutty [35]
A. Yes is correct. Hope that helps!
5 0
3 years ago
What do we mean when we refer to a cell as differentiated?
Otrada [13]

Answer:

We mean that a cell changes to another type of cell.

Explanation:

<em>Stem cells </em>are a type of cell that has the potential to become a specialized cell, this change or differentiation, is possible thanks to the activation or deactivation of certain genes that promote (or inhibit) the expression of certain proteins that origins different types of cells (fmuscle cells, osteocytes, neurons). This differentiation happens when the cells receive cues internally ( through signals or contact between a group of cells and another or through transcription factors) or externally.

Then, a differentiated cell is a cell that had gone under the previously described process.

I hope this information is useful to you!

6 0
2 years ago
What is a group of organisms of the same species that live in an area
pantera1 [17]
The answer is a population.
6 0
2 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Alligators have internal and external development, which class might they belong to? A. Amphibia B. Reptilia C. Osteichthyes D.
    6·1 answer
  • Acetyl-CoA can be generated by which three metabolic pathways for potential use by the Citric Acid Cycle for energy metabolism?
    13·1 answer
  • What type(s) of respiration occurs in the<br> absence of oxygen?
    8·1 answer
  • What cellular processes are going on during this time? Think back to the processes we have studied in this unit.
    6·1 answer
  • The result of gel electrophoresis are shown below with four different strands of dna labled which strand of dna is the longest
    10·2 answers
  • Answer the question in the picture please :)
    14·1 answer
  • What is Photosynthesis.....?!!
    13·2 answers
  • Describe temperate grassland ecosystem characteristics. Include climate, an example of a producer, and an example of a consumer
    12·1 answer
  • How many animals have gone endangered (Just) because of global warming and what are their names?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!