1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nat2105 [25]
3 years ago
15

PLEASE ANSWER THIS QUESTION!!!!! URGENT

Biology
2 answers:
liberstina [14]3 years ago
4 0

I would say C from the process of limitation but not fully sure

Natalija [7]3 years ago
4 0
I believe it is C from the answer choices.
You might be interested in
True or False: According to Klass, research published in the journal Pediatrics described differences in children's brain activa
PtichkaEL [24]

Answer:

True

Explanation:

According to Perri Klass, an American Professor of Journalism and Pediatrics at New York University, Parent-child reading promote cognitive development in child and it is recommended that parent should begin the practice at child's birth to ensure development of good reading habit and promote learning in children.

3 0
4 years ago
What does the word biomass mean?
mixas84 [53]

Answer:

Organic matter used as a fuel, especially in a power station for the generation of electricity.

<em><u /></em>

<em><u>Hope this helps :)</u></em>

<em><u>Pls brainliest...</u></em>

<em><u /></em>

6 0
3 years ago
Read 2 more answers
Based on fossil evidence about how long ago did the first single celled life form appear on earth
larisa [96]

The first single celled life form appeared on earth roughly about 3.5 billion years ago

5 0
3 years ago
Read 2 more answers
A relationship in which one species benefits and the other neither benefits nor is harmed is
Komok [63]

Answer:

Commensalism is a long-term biological interaction (symbiosis) in which members of one species gain benefits while those of the other species neither benefit nor are harmed.

Explanation:

7 0
3 years ago
Read 2 more answers
Ways of transmission of coronavirus from infected person to others?
Hatshy [7]

Explanation:

We know that the disease is caused by the SARS-CoV-2 virus, which spreads between people in several different ways. The virus can spread from an infected person's mouth or nose in small liquid particles when they cough, sneeze, speak, sing or breathe.

3 0
3 years ago
Other questions:
  • true or false: the fungi that cause some diseases can spread easily because they produce spores at the site of the infection
    6·1 answer
  • The signals for voluntary muscle movements originate in a band of tissue called the _____, which is located on the _____ lobe.
    10·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The belief that sexual orientation is a function of hormones and other physiological processes is associated with which theory?
    13·1 answer
  • Which elements are recycled in the carbon-oxygen cycle
    12·1 answer
  • Which of the following is not a possible effect of tasing carbon dioxide levels on plants
    8·1 answer
  • ¿Cuál organismo dio origen a todos los seres vivos que existen?
    9·1 answer
  • What is the answer to this
    15·1 answer
  • All living things that lack a nucleus are called prokaryotes<br>True or false
    9·2 answers
  • Small aquatic organisms, such as coral, are the producers of the ocean. Please select the best answer from the choices provided
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!