1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vampirchik [111]
3 years ago
13

What type of plate boundary is illustrated in Figure 9-2?

Biology
1 answer:
Irina-Kira [14]3 years ago
4 0

Answer: (A). Covergent oceanic-oceanic boundary

Explanation:

You might be interested in
How would a small, uncharged lipid move across the cell membrane?
ElenaW [278]

Answer:

Through simple diffusion, down the concentration gradient.

Explanation:

The phospholipids of the membrane are amphipathic with hydrophillic heads and hydrophobic tails. Other polar molecules cannot go through this hydrophobic interior. Since small uncharged lipids are non polar and hydrohobic, they are able to go through the membrane without the help of transport proteins. Therefore, the last two options can be ruled out because facilitated diffusion includes the use of a protein. Diffusion involves molecules moving down the concentration gradient so the second option can be ruled out.

5 0
3 years ago
What am I?
nalin [4]
I think the answer is the sun but i could be wrong
7 0
3 years ago
What type of cells, sex cells or somatic cells ,are produced by this process
pogonyaev

Answer:

Human sex cells are produced by a two-part cell division process called meiosis.

Explanation:

Through a sequence of steps, the replicated genetic material in a parent cell is distributed among four daughter cells. Meiosis produces gametes with one-half the number of chromosomes as the parent cell

3 0
3 years ago
Which statement is true?
Ludmilka [50]

I think b. Proteins are polymers of amino acids is the correct answer

3 0
3 years ago
Sheryl is observing ovarian slides taken from a female ape. All the cells show crossover chromosomes. What is this stage?
Kobotan [32]
<span>The stage at which all the cells show crossover chromosomes is meiotic prophase I. The crossover is the exchange of genetic material between homologous chromosomes. Homologous chromosomes are present in the meiosis I. Regarding the phase of meiosis I, it is expected that the crossover takes place in meiotic prophase I since homologous chromosomes pair up in the prophase.</span>
5 0
3 years ago
Other questions:
  • David was in a car accident and needed a blood transfusion due to his injuries. His brother, Steve, went to the hospital hoping
    15·1 answer
  • Which of the following partially determines the amount of energy carried by a water wave?
    5·1 answer
  • What describes the structure of a DNA molecule
    13·1 answer
  • The terms aerobic fitness and cardiorespiratory fitness mean the same thing<br> True or false?
    15·2 answers
  • On strategy for protecting biodiversity in an area is by using?
    12·1 answer
  • Which statement indicates that the patient who is taking an adrenergic-blocking drug understands the importance of avoiding othe
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • On the graph to the right, indicate which curve corresponds to each type of chlorophyll. Which curve corresponds to chlorophyll
    5·2 answers
  • En países con estaciones se puede apreciar que en otoño y en invierno, muchos
    5·1 answer
  • At what stage is the DNA in the nucleus of the cell, loosely coiled?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!