1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali5045456 [20]
3 years ago
11

When people eat food high in proteins, such as meat, eggs, and cheese, the body breaks down the protein into smaller molecules.

What is supplied to the cell when the body breaks down protein?
Biology
2 answers:
arlik [135]3 years ago
5 0
Energy is given to the body.
Anna007 [38]3 years ago
3 0
Hope this helps......
You might be interested in
Antoinette was diagnosed with hypertension, a noncommunicable disease in which her blood pressure is higher than normal.
kozerog [31]

Answer:

Antoinette was diagnosed with hypertension, a noncommunicable disease in which her blood pressure is higher than normal.  What is the most likely explanation for why she is hypertensive?

Antoinette condition which is hypertension could be as result of excessive stress and deep thought which makes the heart beat the work excessively by pumping more blood and over work the normal working rate.

Anxiety might also contribute to such as well, life burden could enable Anoinette to have such condition.

Explanation:

7 0
3 years ago
how would a variety of organic compounds be different if carbon had seven electrons in its outermost energy level instead of fou
ivolga24 [154]
The variety would be less, this is because if carbon had seven electrons then it wouldn't be able to bond with as many different atoms at the same time.
5 0
3 years ago
the gemone of an organism is its total genetic material what aspect of the gemone can and cannot be determined through karyotypi
blondinia [14]
Karyotyping can give information on a persons sex and chromosomal disorders. It cannot give information on a persons trait's and how severe a disorder is.
4 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
What type of solution is perfect for animal cells?
aliina [53]
Isotonic since in a hypertonic solution the cell would shrivel up and in a hypotonic solution it would lyse (burst).
3 0
3 years ago
Other questions:
  • The heat transferred to the ice increases the thermal energy of the molecules of water. Why does this cause a change in state?
    6·1 answer
  • A growth composed of more than one kind of neoplastic tissue is called a
    8·1 answer
  • Which statements apply to "food"?
    12·1 answer
  • Each of the following is a function of the integumentary system except:
    6·1 answer
  • If the Sun was the size of a weather balloon (about 1.5 meters in diameter), about how far away would Neptune’s orbit be?
    14·1 answer
  • A 500-gram (g) ball is located on top of a table. Which measurement will the student need to take if he wants to calculate the p
    12·1 answer
  • Need help explaining as well
    7·1 answer
  • HURRY UP PLSS! Complete the passage to summarize factors affecting the speed of a wave.
    12·2 answers
  • 61. Let us assume that hairy toes (hh) and brittle ear wax (ww) are both recessive traits in humans. In families of three childr
    5·1 answer
  • 4. Which of the following is NOT a way that viruses are classifieda. Shapeb. Sizec. Kingdomd. Host
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!