1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Strike441 [17]
3 years ago
11

What is the full form of ATP Can you help me pls

Biology
1 answer:
Oksana_A [137]3 years ago
6 0
ATP stands for<span> adenosine triphosphate</span>
You might be interested in
What are the 2 types of building blocks for<br> lipids?
NISA [10]
The building blocks of lipids are one glycerol molecule and at least one fatty acid, with a maximum of three fatty acids.
Hope this helped you, and have an amazing day.
6 0
4 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Duplication of chromosomes occurs during S phase of the cell cycle. Duplication requires the separation of complementary DNA str
frozen [14]

Answer:

Some statements of the question are missing but it can be understand as the Hydrogen bonds are Easy to break, Less amount of heat required, Less amount of enzyme needed and Can be broken by mild concentration of enzyme.

Explanation:

Weak bonds like hydrogen bonds are found to beneficial in some situations. During the duplication of chromosomes which occurs in S phase of cell cycle the DNA replicated. This replication is facilitated by separation of the two strands of DNA and formation of complimentary strand on the two primary strands. The enzymes involved in the process of separation of strands are DNA helicase and Topoisomerase mainly. As the bonds between the strands are weak hydrogen bonds, the enzymes function effectively without requiring extra heat or more saturation. It will found to be difficult if those bonds will be covalent bonds because they are much stronger than hydrogen bonds and are not easily broken by these enzymes. Extra processes will be required to break those strong bonds.

5 0
3 years ago
Students in a class recorded their resting pulse rates
chubhunter [2.5K]

Answer: (A)

Explanation: I’m smart

6 0
3 years ago
How are the west flowing rivers different from the east flowing rivers
Kazeer [188]
Is this just in general or in a certain area?
8 0
4 years ago
Other questions:
  • The information that determines what an organism will be like is stored in the _____________ molecule.
    10·2 answers
  • Hat is the difference between DNA and RNA?
    11·2 answers
  • Water is known as the universal ______ because it dissolves so many different substances
    13·2 answers
  • Ocular albinism is an X-linked recessive trait that causes a lack of pigmentation in the eyes.
    9·1 answer
  • What are 3 examples of parasitism
    7·2 answers
  • The air density is so low in this layer of Earth's atmosphere that this is the location we normally think of as the start of out
    8·1 answer
  • Why is it important to use greek or latin words for scientific names?
    13·1 answer
  • Many bird species have seasonal behaviors that cause them to _______ or change their location.
    7·1 answer
  • ANSWER AND EXPLAIN PLZ:)
    14·1 answer
  • Does climate change negatively or positively impact ecosystems in a biome?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!