1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler [38]
4 years ago
9

The measurement of the distance from the crown of the infant's head to the infant's heel, while the infant is lying on his/her b

ack with legs extended, is a measurement of:
Biology
1 answer:
solniwko [45]4 years ago
4 0

Answer:

Length.

Explanation:

The measurement may be defined as assigning of the particular number to the measured object. The infants height and weight are measured after the birth.

The measurement of any objects is generally done in terms of the length, weight and circumference as well.  The length can be measured in terms of meters, kilometers, feet and inches. The infants head to the heel measurement is done in terms of the length only.

Thus, the answer is length.

You might be interested in
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
a man with type ab blood is married to a woman also with type ab blood. what percentage of their children will have
jekas [21]
100% Percent will have ab blood

4 0
3 years ago
What is the set point for blood glucose
VladimirAG [237]
The blood glucose level is 7.45.
3 0
4 years ago
The word physical describes the layers of the Earth according to what material makes each layer. True or false?
Zanzabum

Answer:

It's <em>True </em>honey very true

3 0
3 years ago
Read 2 more answers
Drag the pink labels onto the pink targets to identify the two main phases of the cell cycle. Then drag the blue labels onto the
zavuch27 [327]

Answer:

There is no diagram provided so I will just explain the mitotic cell cycle.

Here’s a quick basic arrangement in chronological order interphase, mitosis, and finally cytokinesis.

So first you start with interphase which consist of three phases G1 phase, S phase, G2 phase. Cellular growth occurs in G1 phase of interphase this is followed by S phase which is simply when DNA replication occurs. Final this is followed by G2 phase or further growth in preparation for mitosis and/or meiosis.  

I am only going to explain mitosis but just so I don’t confuse you meiosis can also follow interphase. So mitosis consist of four phases. Prophase, metaphase, anaphase, and telophase.

Prophase: in this phase the nuclear membrane would dissipate and the chromosomes would condense.

Metaphase: then in metaphase the chromosomes would align in the center of the cell and spindle fibers or microtubules would began growth from the centrioles.  

Anaphase: by the start of this phase spindle fibers would have attached themselves to the chromosomes kinetochores. In this phase the chromatids would separate and that’s really it as you can tell this is the shortest phase in mitosis.

Telophase: finally the chromosomes would be brought to the polar opposite ends of the cell and the nuclear membrane would reform. Also the chromosomes condensed chromosomes would unravel eventually they would be invisible.

Finally the cell would enter cytokinesis were it would split at the cleavage furrow which would have started in anaphase of telophase, all a cleavage furrow is, is microfilaments “pinching the cell” which is just them pulling on either side of the center of the cell.

3 0
3 years ago
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • URGENT!!!!
    11·2 answers
  • 1. You homogenize a cell and isolate it from a vesicle derivative from the endoplasmic reticulum. When their biochemistry was an
    7·1 answer
  • A virus is best described as a
    5·2 answers
  • How long does it take for food to digest?
    15·1 answer
  • Summarize Dr. Wasser’s research and how it is being used to conserve elephants.
    7·1 answer
  • Which white blood cells are most important in body immunity?
    5·2 answers
  • A ratio that compares the width and length of a garden is what type of model?​
    8·1 answer
  • How are organisms in the kingdoms Fungi and Animalia similar?
    9·1 answer
  • Why does a cell need to copy its DNA before undergoing mitosis?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!