1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zubka84 [21]
3 years ago
5

The ionosphere is

Biology
2 answers:
IRISSAK [1]3 years ago
4 0

Answer:

the layer of the earth's atmosphere that contains a high concentration of ions and free electrons and is able to reflect radio waves. It lies above the mesosphere and extends from about 50 to 600 miles above the earth's surface.

Explanation:

Gemiola [76]3 years ago
3 0

The first two your welcome

You might be interested in
Which psychological concept did Pavlov's dog help him describe?
Nataly_w [17]

Answer: In his experiment, Pavlov used a metronome as his neutral stimulus. By itself the metronome did not elicit a response from the dogs. Next, <u>Pavlov began the conditioning procedure, whereby the clicking metronome was introduced just before he gave food to his dogs.</u>

Answer is A.

:)

3 0
3 years ago
What is the major advantage of an orbiting telescope
Charra [1.4K]
In space, however, telescopes<span> are able to get a clearer shot of everything from exploding stars to other galaxies. Another </span>disadvantage<span> for ground-based</span>telescopes<span> is that the Earth's atmosphere absorbs much of the infrared and ultraviolet light that passes through it.</span>
6 0
3 years ago
Read 2 more answers
A population of mice has grown so rapidly that there are 2,400 individuals in an ecosystem that will support about 1,800 mice. t
azamat
<span>undergo a dramatic decline in size, possibly to a stable level at or below 1,800 individuals.</span>
4 0
3 years ago
WILL GIVE BRAINLYEST
xxTIMURxx [149]

Answer: I think number 2 b

Explanation:

4 0
3 years ago
What type of cell does mitosis produce?
Alecsey [184]
Mitosis produces all animal and plant cells 
6 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What would MOST LIKELY happen to the grass if most of the fungi and bacteria die?
    13·2 answers
  • Which of these statements best explains how continuation of space exploration would benefit humans?
    11·1 answer
  • Four types of functional groups?
    7·1 answer
  • Why does the shape of the lighted part of the moon change when viewed from earth?
    5·1 answer
  • A married couple has 3-year-old twins. They own a dog. The father's mother lives with them. The father is a professor; the mothe
    13·1 answer
  • Which is the correct sequence of polypeptide transport in the secretory pathway?
    10·1 answer
  • Most of the fossils found in Virginia are in the Coastal Plain, Valley, Ridge, and Appalachian Plateau regions, BEST suggesting
    11·2 answers
  • Which of the following is true about our body's system?
    5·1 answer
  • Is it possible for social experience to make someone homosexual, or are homosexuals born with such a tendency? Then discuss how
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!