1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zigmanuir [339]
3 years ago
13

Because alcohol protons are reasonably acidic and easily undergo exchange, it is important that the base be matched to the appro

priate solvent. Explain why it would be virtually impossible to sort out the factors the size of the base or the stability of the alkenes formed if a reaction were carried out using methanol as the solvent and potassium t-butoxide as the base. In your answer draw a mechanism using methanol and tert-butoxide to illustrate your answer.
I don't understand how to do the mechanism at all. but wouldn't the reasoning have to do with methanol being able to produce methoxide
Biology
1 answer:
Elanso [62]3 years ago
5 0
Potassium tert-butoxide is used to make alkenes by an elimination reaction that does not follow Zaitsev's rule. The compound dissociates into its ionic form, potassium ion and t-butoxide ion. The t-butoxide ion reacts with a haloalkane. Methanol is fairly acidic and it will also dissociate into hydronium and methoxide ions. The methoxide ion will react with the haloalkene and produce a Zaitsev alkene making it difficult to perform the analysis.
You might be interested in
In specialized transduction the bacterial genes transduced tend to be: Select one: a. those genes in greatest use by the bacteri
ioda

Answer:

c. those genes that are located close to the site of the pophage insertion

Explanation:

In Specialized transduction, a restricted group of bacterial genes is passed to a different bacterium. Here, the prophage excises falsely from the chromosome such that the bacterial genes which are close to the site of the prophage insertion take part in the excised DNA.

3 0
3 years ago
Channels allow the appropriate ions or small molecules to pass through.<br> (a) True<br> (b) False
denis23 [38]

Answer:

The given statement is true.

Explanation:

A channel protein refers to a protein, which permits the conduction of particular substances like small molecules or ions through the cell membrane. They perform this task either through the process of active transport or facilitated diffusion on the basis of the concentration gradient or due to the variation in the concentration of components outside and within the cell membrane.

5 0
3 years ago
Which part of the neuron below is indicated by the arrow, and what is its function?
Nesterboy [21]
A. The axon carries information through electrical impulses...
3 0
3 years ago
The purity of cocaine in crack averages about __________.
AnnyKZ [126]
<span>This averages about 75 percent. This type of cocaine is a free base cocaine and is smoked. The high that it gives to the smokers is short but intense. It is also known as the most addictive form of cocaine.</span>
6 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Other questions:
  • How do scientist use models to predict the weather?
    15·1 answer
  • Using the diagram above, which layer is the densest?
    9·1 answer
  • The production of which substance would most likely indicate anaerobic cellular respiration?
    11·2 answers
  • What is an organ system
    9·2 answers
  • CU.
    14·1 answer
  • Which word or phrase below is defined by the following:
    15·2 answers
  • What is the basic form of matter which cannot be broken down any further
    10·1 answer
  • Solve it: which insulin mutations may result in disease? mastering biology
    7·1 answer
  • Which Antimicrobial agent had the highest zone of inhibition for on Streptococcus pneumoniae
    6·1 answer
  • Which statement best describes energy release in cellular respiration? (1 point)
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!