Answer:
A photosynthetic cell within a plant leaf produces chemical energy, stored within glucose molecules.
Explanation:
The energy captured from sunlight by Photosystems in chlorophyll is used to split a water molecule and reduce carbon dioxide to carbohydrates. This energy from sunlight is therefore stored in the chemical bonds of the glucose molecules. It is thereafter harnessed during cellular respiration when the chemical bonds of glucose are broken and the energy transferred to make ATP molecules.
Answer:
The BRCA gene is a tumor-suppressor gene found in the breast; to be more specific, it produces proteins that suppress cancerous activities/abnormal growth in the body. A mutation in a BRCA gene would allow these abnormal growth activities to go unchecked and thus increase the rate of mitosis. Cell cycle checkpoints would significantly be worse at their jobs of checking and correcting for errors during the cell cycle. Tumors would result as well, as cancerous growth continues, and the tumor can become metastatic.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
This organism will be placed in kingdom Animalia, phylum Arthropoda and class Araneae because it has same characteristics to spider and spider also belongs to class Araneae.
Explanation:
Organisms which belongs to class Araneae is known as Arachnids. These organisms are invertebrates and have two body parts i. e. cephalothorax and the abdomen. They have eight legs.
