1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rudik [331]
3 years ago
10

At night, clouds act as a blanket by _____.

Biology
2 answers:
PSYCHO15rus [73]3 years ago
6 0
Absorbing outgoing radiation 
zimovet [89]3 years ago
5 0

Clouds can assist as an umbrella, protecting the earth's surface from incoming cosmic transmission which results in an overall cooling effect. To outgoing long wave transmission, however, clouds assimilate the energy, then release it again, but at their moderate temperature such as they emit lower energy than what they have received and hence act like a blanket by absorbing outgoing radiation.

You might be interested in
What effect does the heating of Earth have on air and water movement? PLEASE EXPLAIN
sammy [17]
Heating of the Earth due to the Sun's rays causes convection currents of air upwards. The warm air moves upwards, while cool air from nearby regions fills in the lower areas. 
<span>Heating of the Earth can cause warm water currents that flow from hot areas like near the equator and tropical areas, while cold water currents flow from the arctic and antarctic regions and the temperate regions. </span>
7 0
3 years ago
Name a type of cell that relies on coupled transport to perform its functions
MrMuchimi
<span>Epithelial cells in the stomach require the use of coupled transport to make gastric acid. They use hydrogen potassium ATPase, which is an electroneutral pump, and exchanges potassium for hydronium in order to produce the gastric acid.</span>
7 0
3 years ago
Earthquakes occur because of _____.
Mice21 [21]
Earthquakes it occur because of they occur when their used tectonic plates it shifted to suddenly. Hope it helped you, and have a great day.

-Charlie
7 0
3 years ago
Read 2 more answers
Will mark brainliest if the answer is correct: ""how does the presence of reptilian and mammalian nephrons provide evidence for
Varvara68 [4.7K]

Answer:

Nephrons in birds, mammals, and reptiles are all extremely similar, more so than other structures in the bodies of different species, solidifying the relatedness through similarity.

Explanation:

Birds can be said to have "mammal-like" nephrons from the number of loops and overall structure of their kidneys, which, although they look very different, serve the same purpose and do it in largely the same way. Reptiles also have mammal-like nephrons, and it can be assumed that this evolutionary trait was kept because the specific structure of the nephrons is generally the most efficient.

3 0
2 years ago
Starch and ATP can both be described as molecules that store energy. Compare and contrast starch and ATP in terms of storing ene
Rudik [331]

ATP only stores energy for a short period of time while starch stores it for a longer period of time.

5 0
2 years ago
Read 2 more answers
Other questions:
  • Explain how the process of meiosis relates to the way in which a child resembles but is not a copy of his or her exact parents
    12·1 answer
  • Where does black line appear?
    8·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Describe two methods that scientists can use to determine whether two species (modern or extinct) are closely related.
    6·1 answer
  • Considering an X-linked dominant trait, if an unaffected woman and an affected man decide to have children, which of the followi
    7·1 answer
  • Mutations that occur in DNA sequences during replication are___
    14·2 answers
  • Scientists from which nations were involved in discovering and describing the strong nuclear force?
    11·2 answers
  • Large ears Survival Advantage
    11·2 answers
  • What type of climate has no winters
    5·2 answers
  • I dont know how to do this ​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!