1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sav [38]
3 years ago
12

What is a nucleus like in real life?

Biology
1 answer:
daser333 [38]3 years ago
5 0
A real nucleus example like a Boos from a Company 
The DNA i like cook cookies 
You might be interested in
Landscape in which limestone is eroded to form deep valleys and caverns
irina [24]
The landscape in which limestone is eroded to form deep valleys and cavers are called Karst landscape or karst topography. This kind of development start occuring whenever the acidic water starts breaking down the bedrocks near the cracks. As the bedrock starts breaking down slowly, the cracks start to open up creating bigger holes. with passage of time the holes will become big enough to create an underground drainage system for the surface water to flow and form underneath. If the water is unable to flow out and becomes stagnant, then the Karst will start getting bigger. 
5 0
3 years ago
Read 2 more answers
A. Which form of nitrogen in the soil is NOT usable by organisms?
Colt1911 [192]

Answer:

A)Fixation. Nitrogen in its gaseous form (N2) can't be used by most living things

B) it can not be used because it most be converted or, ’fixed’  to a more useable form. To do this it goes through a process called fixation.fixation is the change in a gene pool from a situation where there exists at least two variants of a particular gene (allele) in a given population to a situation where only one of the alleles remains.

C) This form can be made more usable if it’s converted. It has to go through the process of fixation so the gene pool changes.

Explanation:

4 0
3 years ago
Read 2 more answers
miRNAs can control gene expression by what action?A. degrading proteins as soon as they are formedB. inhibiting the catalytic ac
levacccp [35]

Answer:

C) binding to mRNAs and degrading them or blocking their translation

Explanation:

<u>miRNAs:</u>

miRNAs is the abbreviation of MicroRNAs. These are the small noncoding RNAs of ∼22 nucleotides which can not code for peptides. miRNAs are responsible for gene expression regulation at the level of post transcription. They can do so by forming complementary base pairing with target mRNA and inhibiting their translation.

They silenced mRNA by the following processes:

(1) Cleavage of the mRNA strand into pieces,

(2) stopping mRNA from translation into proteins by ribosomes.

(3) Shortening of mRNA poly(A) tail and destabilizing it.

5 0
3 years ago
What is the best description of the type of mutation in the DNA strand?
Vladimir [108]
A

addition mutationadeition mutation

so its A
6 0
3 years ago
What are glands in that end messages to target cells
pogonyaev
They are the endocrine glands
6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • According to frank-starling's law of the heart, the cardiac output is directly related to the:
    9·1 answer
  • which statement must be mentioned in explaining why amphipathic molecules line up at a water surface?
    7·2 answers
  • In a forest, a tree falls on a swamp and kills the worm population reducing the population by half. The remaining population is
    10·1 answer
  • What characteristics of living things does a river have?
    6·1 answer
  • This group of substances can produce chemical vapors that can be inhaled to produce a mind-altering effect. stimulants psychoact
    15·2 answers
  • Help with this please???
    8·1 answer
  • Complete the following analogy. Amino acid is to protein as
    7·1 answer
  • All of the following are sources of energy for humans during exercise EXCEPTa.stored ATP.b.alcoholic fermentation.c.lacticacid f
    15·1 answer
  • What occurs during the mitosis stage of the cell cycle?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!