1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
3 years ago
10

Which area of the brain is responsible for coordinating movement and is the region most frequently damaged in association with c

hronic alcohol consumption?
Biology
1 answer:
Veseljchak [2.6K]3 years ago
5 0
The cerebellum. it is one of the key components in what makes us humans, human.
You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
What substances make up carbohydrates what characteristics do carbohydrates have?
Wittaler [7]
They can also use carbohydrates so I don't know
3 0
3 years ago
Use the concept map below to take notes on early research about infectious<br> diseases.
TiliK225 [7]

Answer:

I was not sure on this and not trying to post a link either:( sorry

3 0
3 years ago
The duplication of homeotic (hox) genes has been significant in the evolution of animals because it _____.
USPshnik [31]

Answer;

-Permitted the evolution of novel forms

Explanation;

-Hox proteins regulate other genes. Hox genes code for proteins that attach to molecular switches on DNA, turning other genes on and off. The DNA-binding piece of a Hox protein is called the homeodomain, and it's encoded by the homeobox.

-Hox genes are important as they help lay out the basic body forms of many animals, including humans, flies, and worms. They set up the head-to-tail organization.


5 0
3 years ago
Compare and contrast the trait and growth patterns of opportunistic versus equilibrium populations
coldgirl [10]
The opportunistic has a longer lifespan than the equilibrium populations
6 0
3 years ago
Read 2 more answers
Other questions:
  • Briefly define the purpose of the following organelles: Nucleus, Ribosome, Nucleolus, RER (Rough Endoplasmic Reticulum), SER (Sm
    12·1 answer
  • Carbon dioxide would be classified as:
    6·2 answers
  • Rough er is connected to the_________ membrane and to ______ er
    5·1 answer
  • 1. Describe the process of germination and plant growth you observed in the lab activity for a dicot plant.
    8·1 answer
  • How do antibiotics help your immune system deal with infectious agents?
    11·2 answers
  • A space or room within the heart
    15·1 answer
  • Let's begin by taking a step back and considering leukemia and lymphoma in general. We learned that an important way to classify
    9·1 answer
  • Even if a “rudimentary organ” actually has a function about which we observers are unaware (e.g., if vestigial pelvic bones of a
    8·1 answer
  • There were two populations of coyotes on either side of the Colorado River. Since the water was high, they were not able to inte
    7·1 answer
  • What is the density of a rock which has a mass of 35 grams and a volume of 7 cm3
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!