1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liula [17]
3 years ago
10

Much like a cell , a virus is able to

Biology
1 answer:
Virty [35]3 years ago
4 0
<span>Similarly to cells, viruses can spread and grow, as well as mutate. They can change what they do becoming even more deadly or they can become immune to medicine. They can also spread from cell to cell, then from people to people, change the way they spread as they mutate, and many many other things that are usually bad for humans.</span>
You might be interested in
Describe the relationship between evolution, genetic mutation, and the environment. ​
Nadusha1986 [10]

Answer:

The meaningful differences between organisms in a population are genetic. Variations in the genome of members of a population arise through mutation. Occasionally, a mutation occurs in an individual that is beneficial, that helps that organism be better able to survive and repoduce in its current environment.

6 0
2 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
NO NEED TO ANSWER ALL! WOULD BE HELPFUL THOUGH :)
frutty [35]

Answer: question 6

Explanation: Biogeography The fossil record, Embryology, similarity and vestigial structures, genetics and Observable evolution on small timescales.☺

8 0
3 years ago
In what forms do we find most of the water that is present on mars?
Fittoniya [83]

Answer:C

Explanation:

Dont take my word on it but thats what I think.

4 0
3 years ago
Read 2 more answers
5 Alcohol is absorbed by the body much faster than food because _...
aksik [14]
Because alcohol doesn't need to be digested
7 0
3 years ago
Other questions:
  • Both mitosis and meiosis begin with a diploid cell that contains replicated chromosomes.
    8·1 answer
  • Some protists, like the paramecium pictured, live in freshwater. Paramecium have contractile vacuoles, which act to pump water o
    5·1 answer
  • At which boundary does subduction stop occurring, resulting in a mountain range?
    5·2 answers
  • Give one example of an extrinsic homeostatic mechanism overriding an intrinsic homeostatic process.
    10·1 answer
  • Which statement below best describes how biodiversity contributes to the sustainability of an ecosystem?
    7·1 answer
  • Ignore this thx sjshgfkskwka
    10·1 answer
  • Which earth layer us inferred to be composed of solid nickel and iron
    12·2 answers
  • Ecosystems change when _______.
    7·2 answers
  • Which of these is an example of an achieved status? a. African American b. daughter c. adolescent d. husband
    7·1 answer
  • I need the awnsers asap!! please and thanks
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!