1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
butalik [34]
4 years ago
13

Letter D represents a wave's _____. A)crest B)trough C)wave height D)wavelength

Biology
2 answers:
Anton [14]4 years ago
5 0

Answer: B) trough

Explanation:

A) Crest is the top or the highest point of the wave.

B) Trough is the bottom or the lowest part of the wave.

C) wave height is the vertical distance between the crest and the trough.

D) Wavelength is the distance between two successive wave crests or wave troughs.

Thus letter A represents wavelength, letter B represents wave height, letter C represents crest and letter D represents trough.

hichkok12 [17]4 years ago
3 0
Answer would be B. Trough
You might be interested in
What specific naming system did Carolus Linnaeus develop?
Nutka1998 [239]
Classification is the answer
4 0
4 years ago
Read 2 more answers
What are the metric units for acceleration?
liberstina [14]

Answer:

meter per second squared

4 0
3 years ago
Archaeopteryx fossils show that the animal had feathers like a bird. It also had a bony tail, teeth, and claws on its wings like
rusak2 [61]
The right answer for the question that is being asked and shown above is that: "b. Archaeopteryx fossils share traits with both birds and reptiles." 
8 0
4 years ago
Which of the following provides evidence for the hypothesis of punctuated equilibrium
max2010maxim [7]
I think the answer is c

hoped i helped

8 0
3 years ago
The oceans cover about 70 percent of the Earth's surface. Ocean water contains salts and we say that ocean water has a certain s
Veronika [31]

Answer:

The salt in the oceans comes from weathering and the erosion of the earth's crust.

Explanation:

The weathering can be described as the breaking down of rocks.

During the weathering of rocks, minerals will be dissolved from the land and salt is one of them. These minerals (salt included) will then be delivered into the oceans by erosion of the Earth's crust.

Erosion can be aided by wind, ice or water. Erosion removed weathered materials. When these weathered materials are removed, new materials (rocks) will be exposed to weathering thereby promoting continuous weathering processes

4 0
3 years ago
Other questions:
  • Lisa lives in a city that has an average monthly rainfall of 71 millimeters. It has warm summers, and is hottest during July, wi
    10·2 answers
  • What does the rock and fossil represents?
    11·1 answer
  • Photorespiration can decrease soybeans’ photosynthetic output by about 50%. Would you expect this figure to be higher or lower i
    6·2 answers
  • Both coal and diamonds are forms of elemental carbon. Coal is brittle while diamonds are considered to be the hardest of all sub
    12·1 answer
  • Suppose that a biochemist performs an experiment that indicates that the recommended daily allowance of Vitamin E (C29H50O2) sho
    9·2 answers
  • What is the most important safety rule for you to follow in the laboratory
    5·2 answers
  • You overheard a classmate in the hallway say the following statement.
    5·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • How long do monoclonal antibodies stay in your system
    15·1 answer
  • Describes prokaryotes and eukaryotes
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!