1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andre [41]
3 years ago
14

Are plants completely independent from other organisms ​

Biology
1 answer:
padilas [110]3 years ago
6 0

Answer:

no

Explanation:

while they may be a bit different they are considered an organism

You might be interested in
HELP PLSSS<br> what are the differences between voluntary and reflex actions?
marshall27 [118]

Answer:

Voluntary are actions you consciously do where as reflex actions are just a reflex you don’t think about them you just do them

HOPE THIS HELPS

-Todo ❤️

Explanation:

7 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
The area of a circle is 173 square inches. find the radius
AnnZ [28]
The radius of the circle would be 7.42in
5 0
3 years ago
Read 2 more answers
Why do you think DNA is duplicated before
Anna71 [15]

The two cells that result from a single cell need to have the same amount of genetic material as the initial cell, therefore the DNA needs to be duplicated before the cell divides.

The sister chromatids are attached together so that during anaphase the daugther cells will receive the same chromosomes

5 0
3 years ago
Which of these items would be a renewable resource?
scZoUnD [109]
Fish would be renewable since they can be reproduced.

We cant make gold, or oil, and gasoline comes from oil, so all are non-renewable

3 0
3 years ago
Read 2 more answers
Other questions:
  • In the pea plant, the allele for green pod color (G) dominates the allele for yellow pod color (g). The Punnett square illustrat
    6·2 answers
  • Where is the magnet that causes Earth’s magnetic field located? What is this magnet made of?
    10·2 answers
  • If an elephant's cell were to lose ability to perform aerobic cellular respiration, would would most likely happen?
    5·2 answers
  • SOMEONE PLEASE HELP ME??
    15·1 answer
  • Coelacanths and lungfish are collectively known as the lobe-finned fishes, and have fins containing similar arrangements of bone
    7·1 answer
  • Which of the following would be an example of how a model can be used in science.
    9·1 answer
  • When amino acids are linked together to form chains the molecule formed is called what?
    9·1 answer
  • Hemophilia is an example of
    9·1 answer
  • The composition of ocean water can change.<br> True<br> False
    12·1 answer
  • 30. The sweeper tentacles of corals contain:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!