1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spayn [35]
3 years ago
7

How many ml of water would be displaced by 408g of lead

Biology
1 answer:
Alexxx [7]3 years ago
5 0

Answer:

408 grams therefore has a volume of (408/11.35) = 35.947cc. It displaces 35.947cc of water, = 35.947 millilitres. When lead is put in water, it will displace same volume of water. Therefore, 408 g of lead will displace 36 ml of water.

You might be interested in
5. Why do populations have variation in certain traits?​
Molodets [167]

Answer:

Variations are caused by mutation. random mating between organisms.

Explanation:

4 0
3 years ago
an organism is classified as a carnivore. is it a heterotroph or an autotroph? is it a producer, consumer, or decomposer?
kobusy [5.1K]

Heterotroph. Consumer

3 0
3 years ago
Is a hamster a primary consumer? Why?
Fiesta28 [93]

Answer:

A hamster is a primary consumer because it feeds on primary producers (plants).

5 0
3 years ago
Name the red pigment inside red blood cells that help to carry oxygen.
Ksju [112]

Answer:

Hemoglobin.pulmonary artery.

Explanation:

1. about hemoglobin.Hemoglobin is the protein inside red blood cells. It carries oxygen.

2. about pulmonary artery.The pulmonary artery is a big artery that comes from the heart. It splits into two main branches, and brings blood from the heart to the lungs. At the lungs, the blood picks up oxygen and drops off carbon dioxide. The blood then returns to the heart through the pulmonary veins.

3. There exist a concentration difference of carbon dioxide and oxygen inside the alveoli and capillaries due to which the diffusion of the two gases takes place. The carbon dioxide moves from the blood to the alveoli sac and the oxygen moves from the sacs to the blood.

3 0
1 year ago
What is a category of ai that attempts to emulate the way the human brain works?
KIM [24]

Category of AI that attempts to emulate the way the human brain works neural network.

A neural network is a biological neural network made up of biological neurons or an artificial neural network used to solve artificial intelligence (AI) problems.

Artificial neural networks model biological neuron connections as weights between nodes. An excitatory link is represented by a positive weight, whereas an inhibitory connection is represented by a negative weight. Each input is given a weight before being added together.

These artificial networks can be applied to adaptive control, predictive modelling, and other tasks where a dataset can be utilised to train them.

To learn more about artificial intelligence, refer this link brainly.com/question/28448080

#SPJ4

8 0
1 year ago
Other questions:
  • In many cells, the structure that controls the cell's activities is the
    13·1 answer
  • Why are fossils not found in igneous rocks?
    14·2 answers
  • Greenhouse gases create an insulation layer in the atmosphere and help retain heat for our planet earth. much of this gas is pro
    5·1 answer
  • What day does a plant make the most sugar?
    13·1 answer
  • Which statement below defines epistasis?
    9·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What's used to engulf food?
    7·1 answer
  • How can you help in reducing the problem of waste disposal give any two methods​
    11·1 answer
  • SpongeBob and his pal Patrick love to go jellyfishing at Jellyfish Fields! The fields are home to a special type of green jellyf
    10·1 answer
  • Thế giới sinh vật được phân chia thành những nhóm gì
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!