1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
The nurse is caring for a client who was found after spending 2 days without food or water in the desert and was admitted throug
Nadusha1986 [10]
<span>The human body requires liquid for the production and movement of blood cells, to prevent too low of a dip in blood pressure, and to guarantee that oxygen reaches the brain. All of these problems can be caused by dehydration and, if not treated in time, can be debilitating and even fatal.</span>
3 0
4 years ago
What does the order of DNA bases have to do with the traits of an individual?
Elena L [17]
It tells you if your going to be tall or short big or Slim it can tell you your traits

8 0
3 years ago
Which of these best describes the process by which these organisms<br> obtain energy ?
katrin [286]
I think its anaerobic respiration
3 0
3 years ago
A scientist has crossed purple-flowered four-o'clocks and obtained 248 offspring of which 188 purple and 60 white. From Mendel's
liraira [26]
The Chi Square value for this cross is 0.086. The degrees of freedom is 1 and using a p value of 0.05, it can be proved that there is no significant difference between the observed distribution and the theoretical distribution. Thus, we accept the results.
6 0
4 years ago
According to the information provided in this lesson, which of the following falls into the category of a "club drug"?
iogann1982 [59]
You did not give any details so...

But, I do know that 'Molly' is a 'club drug.'
3 0
3 years ago
Read 2 more answers
Other questions:
  • A student argues that two species of birds are the same species because they have similar body structures, similar DNA, and simi
    12·2 answers
  • Our Sun is considered a(n) _____ star. A. small B. large C. giant D. average
    8·2 answers
  • Plants do not just use photosynthesis to make sugar for energy storage. Identify other kinds of uses plants have for these subta
    15·1 answer
  • What are some strategies that can help erin identify high-fiber whole-grain foods when she shops?
    14·1 answer
  • The fatty tissue surrounding the kidneys is important because it ________. A. is necessary as a barrier between the adrenal glan
    15·1 answer
  • A mammalian skull is found in a forest. The skull has incisors, small canines, and many large premolars and molars with prominen
    6·2 answers
  • What macromolecule is found in fruits and vegetables?
    8·1 answer
  • What is the most important property of water for living things
    15·2 answers
  • What structures do all organisms have in common in the earliest stages of embryonic development
    12·1 answer
  • Helpp me with my unit test please ​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!