1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
Imagine you are a detective examining a crime scene. You are trying to
Troyanec [42]

Answer:

C

Explanation:

5 0
4 years ago
The constitutional convention began as what ?
Rainbow [258]
If u mean what it was originally called for then

Answer:
it was originally and officially called for to revise the articles of confederation, and unofficially called for to decide how America should be governed.
8 0
2 years ago
Read 2 more answers
Members of Chondrichthyes are thought to be descended from fishes that had ________.
ella [17]

The correct answer is B. A bony skeleton

Explanation:

In biology, Chondrichthyes are mainly marine jawed fishes that have cartilage skeletons rather than bone skeletons and also they have paired fins, this includes animals such as rays and sharks. In terms of origin, it is believed this type of fishes are mainly linked to placoderms that were a type of primitive fish that lived during the Devonian period that had a body skeleton as they were covered by hard structures called plates made of bone. Because of this, it is believed this structures evolved into less rigid ones made of cartilage although both the primitive fish and modern Chondrictyles share features such as the structure of jaws. Therefore, Chondrictyles descended from fishes that had a bony skeleton.

6 0
3 years ago
How should u test a hypothesis
svlad2 [7]

You can test the hypothesis by experimenting.

In this step, you can find out if your hypothesis is true, and draw a conclusion through the outcomes.

hope this helps

3 0
3 years ago
Protists exhibit different characteristics based on the phylum they are included in. Which of the following characteristics woul
Umnica [9.8K]

Protists belong to the group eukaryotes (having their DNA enclosed inside the nucleus). They are not plants, animals or fungi but they act like one. They can be in general subgroups such as unicellular algae, protozoa and molds. They thrive in environments with little sunlight. But they are not plant-like organisms. The answer is letter B.

6 0
3 years ago
Other questions:
  • A dog and a pig attempt to mate. we are aware that these are two different animal species. but what is the best explanation for
    10·1 answer
  • If a substance can move across a membrane than it is said to be
    7·1 answer
  • Only eukaryotic cells are capable of photosynthesis, because photosynthesis requires chloroplasts
    13·2 answers
  • The nurse is assessing a primipara's fundal height at 36 weeks' gestation and notes the fundus is now located at the xiphoid pro
    10·1 answer
  • Against which structure do the circular and longitudinal muscles of annelids work?
    15·1 answer
  • Why are the ventricles of the heart so much larger than the atria of the heart?
    7·1 answer
  • How does the suns energy cause a hurricane to form
    12·1 answer
  • What structural adaptation of the A. cristatus lizard helps them on land?
    13·2 answers
  • I wanted to know if this true or false ?
    15·1 answer
  • Ice is more reflective than dirt or rock. true or false​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!