1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
A plausible explanation of Rachel Carson's description of a photo from the ocean's deep
MakcuM [25]
The answer is False
8 0
3 years ago
True or false: Theoretically, it is possible (but very difficult) for a population to not evolve for a while.
Debora [2.8K]

It is true that it is possible for a population to not evolve for a while.

There is something called the Hardy-Weinberg theorem, which characterizes the distributions of genotype frequencies in populations that are not evolving.

There are 5 Hardy-Weinberg assumptions:

  • no mutation
  • random mating
  • no gene flow
  • infinite population size
  • and no selection (natural nor forced).

You can see that some of these are kinda extreme and really hard to get, but with approximations, we can work.

For example, instead of an "infinite population size" we have enough with a really large population, such that genetic drift is negligible.

Concluding, yes, it is possible (but really difficult) for a population to not evolve for a while (at least, in nature), as long as the 5 assumptions above are met.

If you want to learn more, you can read:

brainly.com/question/19431143

7 0
3 years ago
The cell cycle is a series of events that take place in a cell, leading to its growth, division and duplication. Cell division r
Crazy boy [7]
As ribosomes make their proteins, they may attach to the rough ER and insert the protein into the interior of the ER. The ER then begins folding the new proteins and transports them to areas in which chemical processing takes place
8 0
3 years ago
Read 2 more answers
Which of the following human activities would affect the natural cycles on Earth? A. Burning fossil fuels C. Factories giving of
loris [4]
Most likely D. all of the above
7 0
2 years ago
Read 2 more answers
Arrange the inner layers of the Sun in order starting with the innermost layer.
andrew11 [14]

Answer:

B, A, C, D

hOPE THIS HELPS:)

4 0
3 years ago
Other questions:
  • Huntington’s disease usually occurs in middle age and results in the loss of muscle coordination and cognitive abilities. This d
    6·1 answer
  • If cordycepin triphosphate is added to a cell-free transcription reaction, the nucleotide is added onto the growing rna chain bu
    9·1 answer
  • Which of the following statements is true?
    13·1 answer
  • Amanda is eating a chicken breast, and wonders how many chromosomes are in each somatic cell of the unfortunate bird. She looks
    12·2 answers
  • What conclusion can you draw from the following data?
    13·2 answers
  • What is natural selection and how does it lead to diversity in organisms?
    6·1 answer
  • Please help and fast and no guessing i will report if wrong.
    14·1 answer
  • Cellular respiration converts the energy of fuel molecules to a form of energy that a cell can use to perform work. In an averag
    10·1 answer
  • Which statement best describes how ectothermic animals are different than endothermic animals?
    9·2 answers
  • Which statement best explains how mutations change the shape of flu virus antigens, preventing the attachment of antibodies?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!