1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
What is produced by the lymph system?
gulaghasi [49]

Answer:

the answer is the white blood caells.

7 0
4 years ago
Read 2 more answers
HELP!!! WILL GIVE BRAINLIEST TO BEST ANSWER. 40 POINTS!!!
dedylja [7]
Not really sure but I think is that rodents mate randomly but wait for someone else to answer cause I’m not 100% sure
7 0
3 years ago
What does a food chain diagram illustrate?
AlekseyPX
The answer is C) one pathway of feeding in an ecosystem :)))
6 0
3 years ago
Read 2 more answers
Describe how lymph nodes and organs help the immune system fight pathogens.
I am Lyosha [343]

The defense system of the human body is made up of entire organs and vessel systems like the lymph vessels, but also of individual cells and proteins. The inner and outer surfaces of the body are the first barriers against pathogens (germs). These surfaces include the skin and all mucous membranes, which form a kind of mechanical protective wall.

Several things support this protective wall:

<span><span>- The body’s own antibacterial substances can disable different pathogens from the environment at an early stage. A certain enzyme found in saliva, the airways and tear fluid destroys the cell walls of bacteria.
</span><span>
- Many pathogens that are breathed in get stuck to mucus in the bronchi and are then moved out of the airways by hair-like structures called cilia.
</span><span>
- Most pathogens that enter the body together with food are usually stopped by stomach acid.
</span><span>
- Normal flora, harmless bacteria that reside on the skin and many mucous membranes in the body, also help to protect the body.</span></span>

The cough and sneeze reflex can also help to remove pathogens.


Hope this helps (:

4 0
3 years ago
Read 2 more answers
An overlap in the niches of two species will most frequently result in interspecific cooperation A a hybridization of species B
lara [203]

Answer:

The correct answer is D. interspecific competition

Explanation:

Niche overlap occurs when two species share a same niche and use the same resource. So niche overlap most frequently leads to competition between these two species called interspecific competition.

So In interspecific competition, the individuals of two different species fight for the same resource present in their niche for their survival. For example, lions and leopard share the same niche because they prey on similar types of animals like deer, wild pigs, etc.

So here niche overlap lead to the competition between these two carnivores. In interspecific competition, one species is more successful than other.

5 0
3 years ago
Other questions:
  • What is needed to convert PGA into G3P in the second step of the Calvin-Benson cycle? carbon atoms from carbon dioxide, RuBP, an
    9·2 answers
  • Plants use sunlight to convert nutrients into energy. What form of energy transfer is taking place?
    7·2 answers
  • 2.
    5·1 answer
  • 5. Suppose a non-native species of beetle is
    14·1 answer
  • Plz help with #33. I have no clue
    11·2 answers
  • Two structures seen in this animal cell are composed of microtubules are produced by the centriole. What are those two structure
    14·2 answers
  • The cells in your body produce wastes as a result of metabolic processes. Body systems work together to remove these wastes in o
    5·1 answer
  • Which refers to the highness or lowness of a sound? pitch amplitude frequency softness
    13·1 answer
  • 1. Describe a flood caused by a rising river. What might cause this?
    14·1 answer
  • Identify the stage of mitosis where the sister chromatids line up on the equator of the cell.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!