1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
What two factors cause differences in ocean water density?
V125BC [204]

The temperature and the salinity


6 0
4 years ago
Read 2 more answers
PLS HELp<br> Flocabulary
kherson [118]
B I think sorry if I’m wrong
6 0
3 years ago
Read 2 more answers
How does the structure of a distinctive layer that is used as a marker determine it's function?​
Margaret [11]

Answer:

Keratin has two main functions: to adhere cells to each other and to form a protective layer on the outside of the skin. In epithelial cells, keratin proteins inside the cell attach to proteins called desmosomes on the surface. The desmosomes act as anchors, holding the cells together.

5 0
4 years ago
The genetic makeup that is responsible for a particular trait
Viktor [21]

Answer:

the genotype is responsible for a particular trait or all of the traits

Explanation:

4 0
4 years ago
Rob looks out his window and sees the Moon pictured above.
balandron [24]

Answer:

waxing gibbous, full moon, the way the sun light is hitting the moon because the moon is orbiting the earth

Explanation:

4 0
3 years ago
Other questions:
  • Which of the following diseases is NOT spread by droplet infection?
    15·1 answer
  • The discovery of pcbs led to a ban on commercial fishing on the _________ river because the chemicals were so concentrated in th
    12·1 answer
  • Which cells are most likely to increase in number as a result of this adaptation?
    12·1 answer
  • Vectors that some Protozoa use transfer disease are
    9·1 answer
  • What effect would average population growth have on land usage?
    13·1 answer
  • Please help me in science!
    8·1 answer
  • How do you discept a owl
    6·1 answer
  • The product of the light independent reaction is?
    8·1 answer
  • Why is Glucose added to the fermenter with bacteria Becillus magaterium
    14·1 answer
  • On the feed lot, what is the base of 70% to 90% of the feed for the beef animal?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!