1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
Why do astronauts eat freeze dried food I space
zmey [24]
Food was cooked, quickly frozen, and then dehydrated in a special vacuum chamber. Freeze-dried food didn't need to be refrigerated and would last a long time. To make most freeze-dried foods, astronauts squeeze water into the food packages and then eat the food after it absorbs the water.
8 0
3 years ago
Read 2 more answers
What is hello in Estonian?
Reptile [31]

Answer: Hello in Estonian is Tere.

hope this helps you :D

3 0
3 years ago
Read 2 more answers
Which of the following describes asexual reproduction?
Artyom0805 [142]

Answer:binary fission in an amoeba

Explanation:

Amoeba reproduces by the common asexual reproduction method called binary fission. After replicating its genetic material through mitotic division, the cell divides into two equal sized daughter cells. ... This leads to the formation of the two daughter Amoebae cell having a nucleus and its own cell organelles.

8 0
3 years ago
40 point just answer it
Arte-miy333 [17]

Answer:

C. both sexual and asexual

Explanation:

In both cases, the parent(s) of the offspring pass down characteristics. Asexual reproduction makes a carbon copy of the parent so they would obviously have the parent's characteristics. Sexual reproduction passes down characteristics of both parents to the offspring.

7 0
3 years ago
An expectant mother should check whether there is adequate blank<br> coverage in her plan.
Helga [31]
Yes, in case anything happens in pregnancy
4 0
3 years ago
Read 2 more answers
Other questions:
  • When two pink flowers (rw) are crossed, there are four equally likely possible outcomes for the genetic makeup of the offspring:
    10·2 answers
  • What type of lava flows from a shield volcano
    11·2 answers
  • The accumulation of small changes in a gene pool over a relatively short period is called: A: anagenesis B: cladogenesis C: micr
    12·1 answer
  • Any substance that can stimulate the production of antibodies and combine specifically with them
    11·1 answer
  • Colored aleurone in the kernels of corn is due to the dominant allele R. The recessive allele r, when homozygous, produces color
    8·1 answer
  • would you expect plants that normally live in the dessert to exhibit more pronounced phototropism than forest dwelling plants?
    15·2 answers
  • Organism's traits depend on the____in its cells.
    11·1 answer
  • Which of the following would likely move through the phospholipids of the
    15·2 answers
  • ____ is the species that plays an especially important role in its community so that major changes in its numbers affect the pop
    9·1 answer
  • There are 2,000 mice living in a field. If 1,000 mice are born each month and 200 mice die each month, what is the per capita gr
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!