1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
Whats are the pros and cons of a endoskeleton?
Softa [21]

Well, an endoskeleton is an internal skeleton, like humans have. Pro: Bones do not get broke as easily, since they are inside of the body. Bones that break also heal more quickly in an endoskeleton, since they have tissue and blood surrounding it and transferring nutrients. Con: The flesh can get easily damaged. There is no shedding with endoskeletons, so a new skeleton cannot be grown in the event of an injury.

7 0
3 years ago
What would happen to the size of the carnivore population if the herbivore population increased?
Korvikt [17]
<span>The correct answer should be that the carnivore population would also increase. Since they eat the herbivores, if the amount of herbivores increased there would be more food for the carnivores so they wouldn't have to worry about anything and could thrive, feeding themselves without worrying for food.</span>
6 0
3 years ago
Read 2 more answers
An individual colony visible on an agar plate is composed of:________.
Fudgin [204]

Answer:

I believe the answer is a single bacteria cell.

6 0
2 years ago
What is the symbiosis of certain bacteria live in human intestines where they get food and also help humans break down their foo
Alja [10]
Here is what all 3 symbiotic relationships are: Parasitism is where one organism is benefited and the other is harmed. Commensalism one organism is benefited and the other one is not helped or harmed. Mutualism is were both organisms are benefited or both help each other. Easy ways to remember symbiotic relationships :)
5 0
3 years ago
Match each of the following muscles with its correct description.
Alexus [3.1K]
A2
B4
C1
D3
I think sorry if I get one wrong
7 0
3 years ago
Other questions:
  • HELP PLEASE Sucrase, lactase, and maltase break down disaccharides into monosaccharides. Monosaccharides are transported to the
    10·1 answer
  • Please help me on this
    11·2 answers
  • Consider the following prairie food chain. Tall grass is consumed by grasshoppers that, in turn, are eaten by mice, and the mice
    14·1 answer
  • Does any tundra<br> lie within the United States?<br> If so, where?
    6·1 answer
  • How are the two strands of a dna molecule bonded together to form a double helix?
    8·1 answer
  • Explain how wastage of food and defosteration contributes to global warming
    9·1 answer
  • How is Bohr's atomic model different from Rutherford’s model?
    5·2 answers
  • How does energy flow in a food chain or web? What happens as it moves up in trophic levels
    12·1 answer
  • You have learned about fermentation and how it can be used to produce food products like yogurt and bread. What other products—f
    13·1 answer
  • How does thermal energy of an object differ from its temperature?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!