1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
Large veins arterioles capillaries large arteries 1. : site where resistance to blood flow is greatest. 2. : site where exchange
STatiana [176]
1. arterioles
2. capillaries
3. large veins
4. large arteries
5. capillaries
6. large veins
7. large arteries
8. arterioles
6 0
3 years ago
Describe the growth and development process of a typical annual plant
GalinKa [24]

Answer:

The plants grow and bloom during the cool season when most other plants are dormant or other annuals are in seed form waiting for warmer weather to germinate. Winter annuals die after flowering and setting seed. The seeds germinate in the autumn or winter when the soil temperature is cool.

(source wikipedia)

7 0
3 years ago
Morphine combined with alcohol can produce _____ effects
soldier1979 [14.2K]
The answer that best completes the statement above is DEADLY. Mixing morphine and alcohol can have deadly effects. We know that morphine is a type of pain killer. How this works is by influencing how the brain perceives pain. On the other hand, alcohol is a depressant. Mixing both can result in lack of coordination, impaired judgment and motor skills. Since the body is too depressed, this may result in coma or death.
7 0
3 years ago
Read 2 more answers
Enzymes increase the rate of a given reaction by lowering what energy?
goblinko [34]
Enzymes increase the rate of a given reaction by lowering Activation E<span>nergy. Hope that helps.</span>
7 0
3 years ago
Write 5-6 sentences that explains roles of Heredity and probability.
stepladder [879]

Answer:

Probability is a method for determining the likelihood of something uncertain occurring. If you flip a coin, you do not know whether it will be heads or tails, but probability can tell you that there is a 1/2 chance of either happening. Probability is a method used to predict the likelihoods of uncertain outcomes. It is important for the field of genetics because it is used to reveal traits that are hidden in the genome by dominant alleles. Probability allows scientists and doctors to calculate the chance that offspring will inherit certain traits, including some genetic diseases like cystic fibrosis and Huntington's disease.

Explanation:

7 0
3 years ago
Other questions:
  • Before DNA replication can take place what has to happen to the DNA?
    9·1 answer
  • Use the following information to answer the question(s) below.
    8·2 answers
  • When blockages in the bloodstream read the Brian it can cause blank?
    12·1 answer
  • Is alcohol broke down by the digestive system
    6·1 answer
  • Which of the following would be considered a limiting resource for a population?
    12·1 answer
  • Define ecological pyramid and indicate the limitations of ecological pyramid​
    12·1 answer
  • 13) Which molecule is used by cells as an energy source?​
    5·1 answer
  • Does this graph show an endothermic of exothermic reaction?
    12·2 answers
  • Is this right, please help. I’ll mark as Brainliest
    14·1 answer
  • Bioaugmentation involves Group of answer choices adding nitrogen and phosphorus to an area in need of remediation. adding specia
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!