1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
The process of cell division that creates sex cells in sexually reproducing organisms is called
Eva8 [605]
<span>The answer is "Meiosis".
 
Meiosis is a cell division process which forms four daughter cells which are different from parent cell. Formed daughter cells have half of chromosomes when compared to parent cells. Hence, Daughter cells are haploid (have single set of chromosomes). This process occurs in the sexually reproductive organisms and formed daughter cells can be either sperms or egg cells according to the gender of living being.</span>
5 0
3 years ago
Read 2 more answers
A population of deer mice
timurjin [86]

Answer: The deer mouse nests alone for the most part but during the winter will nest in groups of 10 or more. Deer mice, specifically the prairie form, are also abundant in the farmland of the midwestern United States.

Explanation: copied

O

4 0
2 years ago
How can a small area in the middle of the desert provide an organism what it needs to survive
pishuonlain [190]
Because the small area of that desert provides the provisions the organism needs. They adapt to their climate, so as long as the desert keeps its supply, the organism will stay
3 0
3 years ago
Read 2 more answers
​The limbic system is most related to ____.
chubhunter [2.5K]
The limbic system is mostly related to emotional behaviours
5 0
3 years ago
The condensation of _____ formed the early oceans. It is an important part of the water cycle. meteorites water vapor living org
Alex787 [66]
The condensation of water vapor formed the early oceans. It is an important part of the water cycle. It is easy to eliminate the other answers in this question. It can't be meteorites, living organisms, or nitrogen.
7 0
2 years ago
Read 2 more answers
Other questions:
  • Venus has an atmosphere that is made primarily of?
    11·2 answers
  • Within eukaryotic cells, there is an intricate network of _______ with unique functions.
    9·1 answer
  • How do genes code for specific proteins and traits?
    8·1 answer
  • Which statement best describes the relationship between activation energy and rate of reaction?
    14·2 answers
  • Plz I need help with this!!
    8·1 answer
  • As a result of the absence of clover, the hairstreak population in this location will MOST LIKELY
    8·2 answers
  • What is the average speed of the car after 3 seconds? A. 5 m/s
    7·1 answer
  • 1. Which of the following best explains how
    8·1 answer
  • I need this filled out that's all.
    5·1 answer
  • Explain the consequences for reproduction it a sperm cell did not<br>have head​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!