1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
What is the difference between Darwin's theory of evolution and Lamarck's theory of evolution ?
nekit [7.7K]
Darwin believed that organisms changed gradually over time,but Lamarck thought they changed suddenly.Lamarck believed that organisms could acquire characteristics during their lifetime that they could pass down to their offspring,but Darwin did not believe these traits could be passed down.Darwin believed that species are still changing,but Lamarck believed they had stopped.Lamarck believed that evolution occurred randomly,but Darwin thought it was the result of predetermined plan.Hope this help you!
7 0
3 years ago
HELP+EXPLAIN PLEASE Describe how a sarcodine, such as amoeba, gets food.
frosja888 [35]
Well, the food is in the environment. I would like to compare it with how bacteriae feed (however my biology is quite rusty), that is, they engulf their food and they "digest" -- not the proper term, since there are no organs to do real digestion -- it.
6 0
2 years ago
In pavlov's experiments ,the ringing of a bell was a/an
Maurinko [17]
I’m not sure but it’s definitely a stimulus and I think if it wants specific terms it is a Conditioned Stimulus
3 0
2 years ago
Plz help
arsen [322]

i think is

The predators’ survival depends on biotic factors.

5 0
3 years ago
Read 2 more answers
Where does photosynthesis take place?
vitfil [10]

Photosynthesis takes place in B. In chloroplasts because that's where the plant's green color is produced.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which two ideas did Darwin use to explain evolution? modern synthesis and natural selection acquired traits and modern synthesis
    11·2 answers
  • What is the definition of hormones ​
    15·2 answers
  • Please help ASAP! I'll give brainliest and 50 points if you have a great answer.
    13·2 answers
  • How do scientific models provide a practical solution for some types of research? Check all that apply.
    11·1 answer
  • Can someone please help me . WIL MARK BRAINLIEST !!
    9·1 answer
  • I know this might be selfish and all but I have a female and male rabbit and I am afraid the female rabbit is going to get preg
    15·1 answer
  • Which BEST describes how the removal of the trees and plants will affect the level
    15·1 answer
  • Suggest why drugs that prevent this reflex action from occurring should be avoided.
    13·1 answer
  • The stars appear to move across the sky every day, but
    15·1 answer
  • 4. What is the transport of fluids in the cell called? *
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!