1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
Which process of cellular respiration generates the most ATP when glucose is completely oxidized to carbon dioxide and water?.
Dima020 [189]
<span>Maximum number of ATP re produced during the electron transport chain and chemoosmosis. During glycolysis and krebs cycle, 4 ATP are produced in total. During the ETC of oxidatie phosphorylation, 4 ATPs are produced.</span>
4 0
3 years ago
Read 2 more answers
What type of vocano forms when mounds are formed by slow oozing lava?
Pepsi [2]
C. Shield Volcano.. think of Hawaiian volcanoes,they are basaltic eruptions, very effusive and unexplosive and are characterised by slow lava movement and very little tephra from the eruption. The basalt erupted is very hard, dense rock and so can be built up easily.
8 0
3 years ago
What is the electromagnetic spectrum? Where does it come from?
Ganezh [65]

Answer:

The electromagnetic (EM) spectrum is the range of all types of EM radiation. Radiation is energy that travels and spreads out as it goes.the visible light that comes from a lamp in your house and the radio waves that come from a radio station are two types of electromagnetic radiation.

4 0
3 years ago
Explain how the inputs of cell respiration, oxygen and sugar change into energy carbon dioxide, and water.
labwork [276]
During photosynthesis, the plant needs carbon dioxide and water-- both of which are released into the air during respiration. And during respiration, the plant needs oxygen and glucose, which are both produced through photosynthesis!
5 0
3 years ago
The mitochondria in our cells release energy (ATP). What is the life function are they performing?
adoni [48]

Answer: The main function of mitochondria is to produce energy for the cell. Cells use a special molecule for energy called ATP.

Explanation: The most prominent roles of mitochondria are to produce the energy currency of the cell, ATP (i.e., phosphorylation of ADP), through respiration, and to regulate cellular metabolism. The central set of reactions involved in ATP production are collectively known as the citric acid cycle, or the Krebs cycle.

8 0
3 years ago
Other questions:
  • Water intoxication is a condition that occurs when a person drinks enough water to significantly lower the concentration of ____
    12·1 answer
  • Which part of a cell is the gel-like fluid in which organelles move?
    8·1 answer
  • HELP ASAP!! DUE TOMORROW!! WILL MARK AS BRAINLIEST IF ANSWERED NOW!!
    12·1 answer
  • How do organisms store and use energy?
    8·2 answers
  • Comets travel in orbits around the Sun. Some comets take less than 200 years to orbit the Sun. They are called short-period come
    8·2 answers
  • In a balanced ecosystem, the number of consumer is?
    14·1 answer
  • What happens when a photon of light hits photosynthesis
    12·2 answers
  • using light intensity, carbon dioxide levels, temperature, and wavelength of light. what is the most ideal conditions for photos
    13·1 answer
  • BRAINLIST to whoever
    5·1 answer
  • If modern organisms have a lot of homologous structures, what inference
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!