1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
Where do marine creatures store carbon in their bodies? What form is it in?
kramer
The tissues other than blood contain most of the CO2 stored in the body. Over 90 % of this tissue CO2 is stored in bone as carbonate (65, 155).

When they die, their carcasses sink to the seafloor, bringing a lifetime of trapped carbon with them. This is called Deadfall Carbon. On the deep seafloor, it eventually can be buried in sediments and potentially locked away from the atmosphere for millions of years.
8 0
3 years ago
HELP! The atomic number of krypton (Kr) is 36, and its mass number is 84. How many neutrons does it have?
timurjin [86]

Answer:

C. 48

Explanation:

Simple thing to bear in mind; The number of neutrons is equal to the Atomic number - the Mass number. Because the Atomic number tells you the number of Protons, whilst the mass number tells you the number of both PROTONS and NEUTRONS. So 84 - 36 is 48. You have 48 neutrons

4 0
3 years ago
Read 2 more answers
Jean Baptist's Lamarck was a pioneer in the field of biology. He is most famous for coming up with a theory to explain how lovin
lutik1710 [3]

Answer and Explanation:

According to this theory, the young of a species may inherit certain physical characteristics which their parents acquired in the course of their daily lives. According to Lamarck, modern giraffes evolved from short-necked ancestors. The long necks develop as a result of stretching to reach the leaves of tall trees. The offspring of these giraffes inherited the long necks.

Lamarck's assumption of acquisition of characteristics by individuals in the course of their lifetimes is true. However, the passing of these traits to their offspring is not true. Acquired characteristics do not cause any alteration whatsoever in the hereditary information contained in the chromosomes. This theory is therefore not valid.

8 0
3 years ago
Read 2 more answers
Most of the population growth is due to growth in ______ countries.
nataly862011 [7]

I believe the answer is poor

5 0
4 years ago
Read 2 more answers
2. Which is an example of interspecific competition?
BartSMP [9]
Inter specific competition occurs when two individuals compete for the same resources. Therefore the correct example would be the squash outgrowing the lettuce.
8 0
3 years ago
Other questions:
  • How can water needs be met if the rate of infiltration is lower than the rate of pumping?
    10·2 answers
  • Plz answer
    12·1 answer
  • What is a high-protein diet commonly associated with?
    9·1 answer
  • How does studying science help you become a better member of society
    12·1 answer
  • BRAINLYEST WHO EVER ANSWERED FIRSSSSST HURRRRRRRRY!!!!!!!
    8·1 answer
  • R is the allele for red leaves r is the allele for yellow leaves If a plant has the genotype Rr, what phenotype does the plant e
    5·1 answer
  • Photosynthesis and cellular respiration are processes that create what for the cells​
    10·2 answers
  • As a collective functional unit, the muscles in the anterior compartment of the leg are responsible for what motion(s):_______.
    13·1 answer
  • Why does your brain feel the same "cool" perception whether a neuron is activated by mint or by cool temperatures? There is only
    15·1 answer
  • A volcano erupts, harming all the organisms in the area. Eventually, small plants grow but are eventually replaced by larger pla
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!