1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
Which of the following accurately describes the role of the energy in cellular respiration?
postnew [5]
Energy is used to break down glucose in the presence of oxygen to produce carbon dioxide and water.
4 0
3 years ago
Help pls :,) 50 points!
PtichkaEL [24]

Answer:

It will most likely decrease.

Explanation:

3 0
3 years ago
Explain the difference between respiration and breathing?
NARA [144]
The difference between respiration and breathing is their functions. Breathing is when your body uses your lungs to inhale and exhale oxygen. Respiration is a chemical reaction where your body uses oxygen to eliminate or break apart Glucose so it could give you energy.

Hopefully this helps :)
4 0
3 years ago
You have discovered a cell type in humans that has an unknown function. The cells are found in the epithelium of the lungs. It a
schepotkina [342]

Answer:

The correct option is a) "decrease the amount of GTP to inhibit microtubule elongation and block secretion"

Explanation:

Since microtubules play a critical role in transporting secretory vesicles, preventing it from elongating will keep it from performing this function. Completely eliminating the microtubules from the cell as suggested in option d will harm the cells and other processes in it because the microtubules also have an integral part to play in maintaining cell shape & structure.

Hope that answers the question, have a great day!

4 0
3 years ago
Lee la siguiente situación, y diseña un experimento. (No tienes que realizarlo)
Lynna [10]

Answer:

- Luis quiere saber si los cristales de yodo pueden disuelverse en distintos líquidos  

- Luis necesita cristales de yodo, agua, alcohol y aceite mineral

- La hipótesis de trabajo puede ser: "los cristales de yodo se disuelven en distintos líquidos", con lo cual la hipótesis alternativa indicaría que los cristales de iodo no se disuelven

- La recopilación de los datos puede consistir en la realización de tres experimentos en los cuales los cristales de yodo son sumergidos en agua (1° experimento), alcohol (2° experimento) y aceite (3° experimento).  

Explanation:

En el método científico, la pregunta científica refiere a una cuestión particular la cual es planteada con el objetivo de responder algún aspecto particular del mundo real. A partir del planteamiento de una pregunta científica es posible formular dos hipotésis denominadas hipotésis nula e hipótesis alternativa, las cuales representan supocisiones contrapuestas que permiten contestar dicha cuestión. Subsecuentemente, los científicos realizan experimentos y/o observaciones que permiten recopilar datos cuyos resultados son utilizados para confirmar (o rechazar) la hipótesis nula. Por otra parte, es necesario resaltar que durante el proceso de experimentación se requiere de la utilización de controles positivos y negativos que permitirán corroborar si dichos experimentos fueron realizados correctamente.

4 0
3 years ago
Other questions:
  • What happens to the sugars that are made during photosynthesis? Choose the correct answer.
    12·1 answer
  • How are starch and glycogen related
    13·2 answers
  • How do the plants in a rainforest contribute to the water cycle?
    8·2 answers
  • Clients with schizophrenia often experience non-adherence to prescribed medication protocols. nurses collaborate with these clie
    13·1 answer
  • How semi-conservative happens?
    10·2 answers
  • 6. Which of the following is NOT a function of the liver? MULTIPLE CHOICE.
    11·1 answer
  • 5 points
    9·1 answer
  • 10. If one strand of DNA is
    7·1 answer
  • Question 1
    15·1 answer
  • Multiple questions I will give you 33 points so help me
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!