1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
PLZ HELP (30 POINTS)
hodyreva [135]

Answer: The answer is D Increasing climate change

Explanation: Which of the following is a direct benefit of using agriscience to optimize land use for animal grazing? hope this helps man

5 0
3 years ago
Read 2 more answers
Can u judge who is the better person out of these 3?..
VikaD [51]

Answer:

 

WHat??????????????????

3 0
3 years ago
Read 2 more answers
Abiotic and biotic factors affecting a rainforest
Ray Of Light [21]

Answer: Abiotic factors in a tropical rainforest include temperature, humidity, soil composition, air, and many others. A few of the many biotic factors in a rainforest would include toucans, frogs, snakes, and anteaters.

Explanation: abiotic factors are non-living things. biotic factors are living things. they both impact the organism living in the environment. remember all biotic factors are dependent among abiotic factors.

3 0
3 years ago
A hawk moth looks much like a crumpled and veined dead leaf, an appearance that helps to protect it from predators. This is an e
Rainbow [258]

Answer:

An adaptation.

it's trying to stay safe from predators in the same way it feeds.

5 0
3 years ago
Which phase comes NEXT?
anyanavicka [17]

Answer:

telophase is the correct answer

Explanation:

sorry if its incorrect.

4 0
3 years ago
Other questions:
  • There are four major biological macromolecules: carbohydrates, lipids, proteins, and nucleic acids.
    5·2 answers
  • What is one reason that scientific names, instead of common names, help scientists to communicate about organisms?
    7·1 answer
  • A client with a long history of cardiovascular problems, including angina and hypertension, is scheduled to have a cardiac cathe
    7·1 answer
  • Ralph wanted to breed a pea plant that produced only purple flowers. He continued to breed purple-flower producing pea plants to
    6·1 answer
  • What does muscle tissue do?
    7·1 answer
  • What happens during G2 phase?
    10·1 answer
  • All 12 body systems interact to maintain ________________.
    10·2 answers
  • Sound travels at 343 meters per second. How far can sound travel in 2 seconds?
    10·1 answer
  • Which of the following processes causes
    13·2 answers
  • Gases do not have a definite shape because?​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!