1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
Which of the following statements is not true?
ser-zykov [4K]

Answer:

c. False

This statement is incorrect because the DNA of bacteria is circular without histones.

Explanation:

a. True

Some archaea have very specific lipids in their membrane. Differently of the bacterias that have usual lipids in their membranes.

b. True

Archaebacteria do not have peptidoglycans in their cell wall

d. True

Methanogenic archaeobacteria are those that use carbon dioxide and hydrogen to produce methane. They are found in the digestive system of ruminants, sewers and swamps.

8 0
3 years ago
Do sex-linked traits that originate from mutated genes found on X chromosome affect one sex more than the other? why/why not
gogolik [260]
Ew sex don’t even ask that kind of question
6 0
3 years ago
What is one major disadvantage in using the pyramid of biomass
Lyrx [107]
The disadvantages of the pyramid of productivity as a representation: The rate of biomass production of an organism is required, which involves measuring growth and reproduction through time. There is still the difficulty of assigning the organisms to a specific trophic level.
4 0
3 years ago
There are different types of nerves or mechanoreceptors located in your skin. Nerves that detect deep pressure are called _____.
balandron [24]
Pacinian corpuscles are rapidly-adapting, deep receptors that respond to deep pressure and high-frequency vibration.
8 0
3 years ago
Read 2 more answers
Which component of peanut butter rutf supplies essential amino acids?
Finger [1]
<span>Which component of peanut butter rutf supplies essential amino acids? Your Answer will be Peanut Butter </span>
4 0
3 years ago
Other questions:
  • The parents of a child with attention deficit–hyperactivity disorder ask the nurse about using medication. what is the most freq
    7·1 answer
  • Which of the following has mechanical energy? bouncing ball water in a reservoir book on a table person running falling tree
    7·2 answers
  • By calculating genetic distance, and using rate of change from molecular clock, researchers can estimate when two lineages diver
    13·1 answer
  • There are several disadvantages for asexual reproduction, what would be an advantage
    7·1 answer
  • In a family of four children, one has type o blood, one has type ab blood, one has type b blood, and one has type a blood. what
    14·1 answer
  • A lack of objectivity and impartiality is called____
    6·1 answer
  • A desert plant called Kalanchoe can reproduce, either with sexual reproduction through flowers, or asexually by budding off mini
    7·1 answer
  • if u bark at other people while losing an argument ur dumb i cant say other words brainly wont let me
    15·1 answer
  • Human activity in the Mojave desert impacts the balance of the ecosystem.<br> A. True<br> B. False
    8·2 answers
  • Hich root does not refer to an endocrine gland?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!