1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
During a routine prenatal care visit, a pregnant woman in her last trimester of pregnancy reports that she has occasional shortn
Gala2k [10]
Shortness of breath is very common in the last trimester of pregnancy. This is because, the baby inside the uterus is growing and it starts to push the uterus that compresses the lungs above the diaphragm. This, leads to restricted expansion of the lungs while breathing and causes shortness of breath. Another reason for shortness of breath can be due to low iron content in the body.
If a pregnant woman in her last trimester reports occasional shortness of breath, the nurse should instruct her to:
1. take deep breath and start doing prenatal yoga
2. sleep on the left hand side
3. practicing good posture and standing straight
4. relax as much as possible
4 0
3 years ago
What is pseudoscience? Students have been comparing pseudoscience with "real" science. Their teacher told them to make a chart c
KIM [24]

Answer:

b and e

Explanation:

i got it correct in usatestprep  :)

5 0
2 years ago
Which accurately describes gymnosperms? Check all that apply. Some of them lose their leaves in winter.Some of them lack seeds.S
AleksandrR [38]
I think that correct answers are:
<span>Some of them lose their leaves in winter. (i.e. <span><em>Larix</em></span>)</span>
<span>They include the tallest plants (i.e<em>.Sequoia)

</em>I don't think they are the oldest type of seed plants, since in the past the classes like progymnosperms and seed ferns existed prior to the gymnosperms. But question isn't absolutely clear to me and I can't be 100% sure.
All of the gymnosperms have seeds unless human grows some seedless variant.
Gymnosperms don't have flowers like angiosperms do, but some people think that cone is kind of flower.
Male cones produce pollen, not female.
Hope I helped :)
<em /></span>
7 0
3 years ago
Read 2 more answers
In the lock-and-key model of enzyme action, the ___________ fits into the __________ of the enzyme
Tpy6a [65]
<span>In the lock-and-key model of enzyme action, the "Substrate" fits into the "Active site" of the enzyme

Hope this helps!</span>
5 0
3 years ago
Read 2 more answers
What is true about a circular orbit?
Paha777 [63]
For Plato users...

A. It is a special kind of elliptical orbit.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Relate the development of plant needles to the occurrence of mutations.
    11·2 answers
  • When molten material hardens into rock on the ocean floor, the domains of the iron it contains
    10·2 answers
  • In the pedigree that is shown, which represents Irene's allele combination?
    14·2 answers
  • This planet is an extremely light colored blue, and is the 7th planet from the Sun.
    8·1 answer
  • Are SA citizens vaccinated against yellow fever?
    7·1 answer
  • In the savannas in Africa, elephants and giraffes both use acacia trees for food. What impact would removing these large animals
    14·2 answers
  • Which of the following would be part of a recyling plan​
    11·1 answer
  • In multicellular organisms, higher levels of organization result from specific interactions of smaller units. Which of the follo
    7·2 answers
  • In a population of heffalumps, there is a single gene that controls the presence of hair. The H allele, which is a complete domi
    15·1 answer
  • In Cuttlefish, large males will protect females from other males to prevent them from mating. However, the small males will mimi
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!