1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​

Biology
1 answer:
Svetllana [295]3 years ago
8 0

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

You might be interested in
The cholesterol associated with animal cell membranes
bekas [8.4K]

Cholesterol is one of the molecules composing the cell membrane. b) makes the cell membrane fluid at room temperature.  

<h3>What is the role of cholesterol in the cell membrane?</h3>

The cell membrane is composed of two lipidic bilayers, cholesterol, proteins, and glucans incrusted in between.

Cholesterol is one type of lipid.

These molecules are incrusted in the membrane between the hydrophobic tails of lipids.

Their proportion on both sides of the membrane is almost the same.

Cholesterol is a significant molecule that contributes to the membrane fluidity, separates phospholipids, and interact with membrane proteins regulating in their activity.

The correct option is b). makes the cell membrane fluid at room temperature.

You can learn more about cholesterol at

brainly.com/question/2114495

brainly.com/question/4551833

#SPJ1

7 0
1 year ago
How many molecules of dna would result from one molecule after five cycles of pcra)10b)14c)5d)32
Sergio039 [100]

i say <u>D.) 32</u> is the answer.

5 0
3 years ago
5. What are the four bases found in DNA?
enyata [817]

Answer:

Attached to each sugar is one of four bases--adenine (A), cytosine (C), guanine (G), or thymine (T). The two strands are held together by hydrogen bonds between the bases, with adenine forming a base pair with thymine, and cytosine forming a base pair with guanine.

Explanation:

5 0
3 years ago
Read 2 more answers
At the end of meiosis 1 how many cells are there
GarryVolchara [31]
Meiosis produces four genetically different haploid cells.

7 0
3 years ago
Women who take fertility drugs to assist in becoming pregnant have increased chances of giving birth to
Nata [24]

The correct answer is option (d) that is dizygotic twins.

The dizygotic twins also known as non-identical twins or fraternal twins, that is, two siblings who come from distinct eggs or ova, which are discharged at the similar time from an ovary and are fertilized by different sperm.

4 0
3 years ago
Other questions:
  • If a forest has many large trees with lots of leaves, what will most likely be found
    15·1 answer
  • Which of the following are likely topics in a biology course?
    9·2 answers
  • Which of the following statements is true? The troposphere is made of layered gases. In the water cycle, the amount of water whi
    6·1 answer
  • Help ASAP! Very easy, 10 points and Brainly ,
    7·1 answer
  • If a homozygous dominant (aa) is crossed with a homozygous recessive (aa) for a given character, the offspring will be _____.
    7·1 answer
  • These are cells which have become modified and specialized within an organism. Example: The gradual formation of organs in the b
    5·1 answer
  • Twin research studies looking at the genetic basis of personality revealed that the trait of _____ has a larger genetic componen
    7·1 answer
  • . What provides most of the water for the water cycle?
    14·2 answers
  • Write a sentence explaining the connection between each pair of words:
    13·1 answer
  • Indicate whether each of the following mutations would likely promote or inhibit apoptosis in cells harboring the mutation(s). E
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!