The Pacific Ocean is. Its area is about 63.8 million square miles.
That's about 46 percent of all the water area on Earth, and about
one third of the total area of the whole Earth ... land OR water.
It's 3...
First you add 3 to both sides.(1/3x^2=3)
Then multiply both sides by 3. (x^2=9)
Then take the square root of both sides. (x=+-3)
Finally since it is asking for the positive solution, you can remove the negative sign and so the answer is 3.
It includes steep mountains like the Andes
Answer:
Leeward
Explanation:
Mountains can act as a climatic barrier by blocking prevailing winds and trade winds from getting to the other side of the mountain.
The area that faces the winds is called the windward side. This side receives most of the moisture picked up by the winds from the oceans. This is why it is wetter on this side.
The LEEWARD side is a lot drier because the mountain blocks most of it and as the winds climb up the mountain, most of the moisture is well spent and fall on the windward side. By the time the wind gets to the other side of the mountain, they are dried up already. The <u>leeward</u> side is the area that faces away from the wind.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
