Why is bread light and fluffy?<br> (This was on my biology packet for fermentation.)

The biggest risk factor for the development of skin cancer is excessive exposure to ultraviolet radiation from sunlight. Exposur

Pepsi [2]

<h2>Uses of Tanning</h2>

Explanation:

Tans from a tanning bed or from the sun are proof of UV radiation harm. Each time you tan you are collecting sun harm which can cause <em>wrinkles, hanging skin, and skin malignant growth.</em>
Tanning meeting can expand the danger of creating skin malignancy.
<em>There is nothing of the sort as a sound suntan.</em> Any adjustment in your normal skin shading is an indication of skin harm.
Proof recommends tanning incredibly expands your danger of creating <em>skin malignancy. </em>
<em>The expansion in skin color called melanin, which makes your skin tan, is an indication of harm.</em>

8 0

2 years ago

In recent years, scientists and the public have raised a number of ethical and legal questions about DNA. Many of the questions

dlinn [17]

ANSWER: The completion of the Human Genome Project

EXPLANATION:

Human Genome Project (HGP) was completed in April, 2003. Genome varies from one individual to another.

The project involved mapping and sequencing of some people and in other to get each chromosome full sequence in individuals.

However, at the beginning of this project, concerns like ownership and privacy of personal genetic information began to spring up. People are afraid that employers may have access to their genetic information and would reject persons with health issues indicated by their unique genes and health insurance companies may also not provide insurance to people that have deficiency.

In the view of this concern, the United States in 1996 passed the Health Insurance Portability and Accountability Act (HIPAA) which guides against the non-consensual and unauthorized release of health information of individuals.

3 0

2 years ago

Which is a gamete? A.Progesterone B.Testis C.Sperm D.Steroid

Sedbober [7]

C. Sperm is the answer

7 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

The scatter plot shows a bus stop where those waiting at the bus are plotted by their height and by

german

cathy

brenda

frada givan

alice

ello

dennis

3 0

3 years ago

Why is bread light and fluffy? (This was on my biology packet for fermentation.)