1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RoseWind [281]
3 years ago
9

Jack is an investigator and he wants to prove that a certain person was present at the crime scene when the crime was being comm

itted. What kind of evidence should Jack look for? Jack should look for .... evidence because the analysis of such evidence can prove whether the person was present when the crime was being committed.
Law
1 answer:
spayn [35]3 years ago
7 0

Answer:

ANYTHING

Explanation:

Jack should look to see if he/she left any finger prints or any signs to anything they touched and if they moved anything, if theres a video camera see if it was rolling or anything possible

You might be interested in
What is the punishment for drunk driving and killing someone
levacccp [35]

Life sentence. Killing someone while driving is called vehicular homicide,  while driving drunk is a DUI. The two together can lead to a life sentence, however, it varies greatly depending on the State and Nation.

I hope I've helped! :)

3 0
2 years ago
What was the Ideal behind the Bill of Rights
andrew11 [14]

Answer:

The Bill of Rights are the first 10 amendments to the United States Constitution. The idea behind the Bill of Rights was to insure certain freedoms and rights to the citizens of America. It put limits on what the government could do and control.

Explanation:

6 0
3 years ago
What are the three arguments concerning the Integration angle in Affirmative Action? (Name all three and explain)
snow_tiger [21]

Answer Integration angle just means peoples perspective on integration!

Explanation:

I had a little trouble reading this so I apologize if it's not correct!

Try rewording the question as: What are 3 arguments people make against integration when it comes to affirmative action?

I sadly do not know the 3 arguments regarding integration in affirmative action, but I hope the way I reworded the question helps! The term "integration angle" is rather confusing.

7 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Which of the following legal issues would a military lawyer potentially help with?
inessss [21]
D is the answerrrrr I think
8 0
3 years ago
Read 2 more answers
Other questions:
  • 1. first cause of First Amendment
    11·1 answer
  • A 5-year corporate bond yields 9%. A 5-year municipal bond of equal risk yields 6.5%. Assume that the state tax rate is zero. At
    10·1 answer
  • How are judicial activism and judicial review related?
    10·2 answers
  • g Which type of case would be appealed automatically to the Texas Court of Criminal Appeals Group of answer choices A capital fe
    10·1 answer
  • What states that the government must follow proper constitutional procedures in trials and in other
    11·2 answers
  • Please help will mark brainliest!
    11·1 answer
  • (BRAINLIEST PLS HELP ME )
    9·1 answer
  • Explain the statute of general application​
    11·2 answers
  • Driving under the influence of prescription drugs is the same as drinking and driving. A)true B)false
    5·2 answers
  • how do you back your car out To The right when you leave The parking lot where should you Turn your steering wheel
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!