Which example does not illustrate genetic engineering?

Biology

2 answers:

34kurt3 years ago

7 0

Answer:

The answer is A.) <u><em>DNA</em></u> is used to determine <u>paternity</u>.

Explanation:

<u>I just took the test </u>and if your like me and watch things like judge Judy and things of that sort she usually says that they take DNA tests to figure out if someone is or isn't THE FATHER. Judge Judy's court is a paternity court.

<h2>Hope this helps!</h2>

Setler79 [48]3 years ago

6 0

A because the dna paternity test is not genetically modified information that something that deals with correlation ppl and other animals

You might be interested in

Please help don’t understand

fiasKO [112]

Answer:

Explanation:

when the amount of snowshoe hares increases, the more food will be eaten. since they are herbivores of the same species, they are competing for the same plant (the willows). the more that's eaten of the plant, the more poison is released, resulting in decreased hare population.

6 0

3 years ago

Does granite form large crystals

Alinara [238K]

Depending on the size of the rock it comes from, yes and no. The smaller the rock, the smaller the crystals and vice versa.

4 0

3 years ago

Read 2 more answers

A student completing an experiment finds that her data do

iren [92.7K]

I'm pretty sure its c or d

8 0

3 years ago

Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG

trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0

3 years ago

Explain the opening analogy of an efficiency apartment and a mansion as it relates to cells and how it applies to cell structure

Mama L [17]

I think it means that even though the homes/cells may appear di²erent, theyall include the same basic essentials. Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions here.

5 0

2 years ago