1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mixer [17]
3 years ago
9

When it comes to something like food preferences, how do genetics and the

Biology
1 answer:
k0ka [10]3 years ago
8 0

1. Genetics and environment influence the trait as it depends upon the adaptation made according to availability and environment.

2. Traits are passed onto either parents after fertilization when 2 genes from either parent is received.

3. Dominant trait is responsible for the phenotype of the individual.

4. The expression of gene is seen by the phenotype expressed depending upon the environmental factors.

Explanation:

The food preferences are based on the traits adapted over the time for digestion and method of eating due to natural selection. The occurrence of beneficial trait for digestion become common in the population as these traits are transferred for better survival and evolution.

The traits in an organism is passed on from parents. During fertilization one allele from each parent is passed onto the progeny. 2 alleles together are called gene. In the process of meiosis only one chromosome is present in germ cell hence no homologous chromosome thus only one allele for the trait is present in each parent.

The alleles of dominant trait mask the effect of recessive alleles during phenotype expression. According to law of complete Dominance the dominant trait gets expressed and recessive trait do not get expressed.

The temperature, external environment, chemicals, light factor, diet etc influences the expression of genes in certain organisms. The effect of these can be seen on the phenotype of the organism.  

You might be interested in
The ultimate source of energy for terrestrial ecosystem is
ExtremeBDS [4]
The answer is the sun .
8 0
3 years ago
Info: I ALMOST HAVE 200 QUESTIONS ANSWERED!
olga_2 [115]

Answer:

Natural selection, mutation, and genetic drift are random events.

Explanation:

A mechanism of evolution in which the frequencies of alleles of a population change with generations because of sampling error is known as genetic drift. It takes place in all the populations of non-infinite size, however, its influences are strongest in small populations.  

Hope this helps :)

7 0
3 years ago
Read 2 more answers
Wetlands support a large number of animal species. Chemical weed killers are dumped into this wetland and the aquatic plants are
fredd [130]

Answer: all the animals in and around the wetlands

8 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
What's earths and the suns sphere?
nignag [31]

Answer:

Everything in Earth's system such as water, land, air, and or living things.

Explanation:

All those things are called "Spheres" or specifically =

1- Hydrosphere (water)

2- Lithosphere (land)

3- Biosphere (living things)

4- atmosphere (air)

4 0
3 years ago
Other questions:
  • Which level has the most biomas? <br> (Ecological pyramid)
    6·1 answer
  • The blood's glucose level ordinarily remains relatively constant because of the activity of
    5·1 answer
  • Euglena are protists that move by means of flagella, and they contain chloroplasts and an eye spot or light receptor. they are c
    6·2 answers
  • Body systems understanding the human body.
    13·1 answer
  • Responda ciências pfvv
    5·1 answer
  • Blood made up of red and white blood cells work together to form
    10·1 answer
  • Which of the following is a specialist species?
    8·2 answers
  • ASAP!!! HELP.
    13·1 answer
  • Meg ran 100 meters in 7.8 seconds. Linda ran 100 meters in 14.5 seconds. Which statement is correct?
    9·2 answers
  • ribozymes are rna molecules that have enzymatic activity. this conflicts with the belief of early molecular biologists that
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!