1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lubasha [3.4K]
3 years ago
7

Help me please,Thanks

Biology
1 answer:
sasho [114]3 years ago
8 0
Stationary front
warm front=2
occluted front=3
stationary front= 4
cold front=1
You might be interested in
What part of the cell theory MOST implies that viruses, for all of their similarities to living cells, cannot be considered a li
alexandr402 [8]

Answer:

According to the cell theory cell is the structural unit of all living organisms and viruses cannot  be considered as living organisms according to this theory

Explanation:

Viruses are not made up of cells and they only contain genetic material like RNA or DNA. since viruses are not made up of cells they do no fit the classification of living organisms. To define living organisms other criterion like reproduction, maintenance of homeostasis and ability to adapt to the external environment are mentioned in  the cell theory.

Viruses have the ability to replicate and adapt to even extreme conditions of their environment which makes the question of classifying viruses in the category of living organisms even more complicated.

5 0
4 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
<img src="https://tex.z-dn.net/?f=5%284x%20%2B%203%29%20-%203%287x%20-%202%29" id="TexFormula1" title="5(4x + 3) - 3(7x - 2)" al
VARVARA [1.3K]

Answer: The answer will be -x + 21

5 0
3 years ago
Good luck I hope this helps
fredd [130]

Answer:

thanks for the answer

Explanation:

brainliest plz

7 0
3 years ago
Read 2 more answers
In most cases, the general interpretive center and the speech center are located in the?
suter [353]

In most cases, the general interpretive center and the speech center are located in the <u>left cerebral hemisphere.</u>

The left cerebral hemisphere, or a side of the brain, is responsible for speech and language, and because of this, it has also been called as the dominant hemisphere. The right hemisphere also plays a large part in interpreting or compiling spatial processing and the visual information.

Hemisphere in brain is one-half of the cerebrum, which controls muscle functions and also controls speech, thought, emotions, writing, reading, and learning. The left cerebral hemisphere controls muscles on the right side of the human body, and the right cerebral hemisphere controls muscles on the left side of the human body.

Learn more about interpretive center here

brainly.com/question/4917278

#SPJ4

3 0
2 years ago
Other questions:
  • How does an emerging idea differ from scientific consensus?
    12·1 answer
  • Argo is explaining coral feeding patterns to his daughter, specifically zooxanthellae interdependence. Which point should he exp
    12·1 answer
  • Which is an immediate result of stopping the glycolysis process?
    11·2 answers
  • Where would you most likely find an organism that belongs to the domain Archaea?
    12·2 answers
  • Consuming two different incomplete proteins to obtain a complete protein involves matching ____________. A) essential supplement
    10·1 answer
  • Does anyone know this question
    8·1 answer
  • Help pls I really need it?
    7·1 answer
  • Which activity will help the students understand the importance of clean water?
    6·1 answer
  • Based on the diagrams above, what is the percent change in the amount of runoff in urban areas compared to forested areas?
    13·1 answer
  • 6. Feeding relationships in ecosystems are best represented by....
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!