There are five levels of cell organization recognized by biologists.
The symptom that the client is experiencing is consistent with the deficiency in the Vitamin A which is a dietary element. The vitamin A is responsible for causing dryness to the eyes if a person is lacking this type of dietary element as Vitamin A is the one responsible for providing healthy vision for an individual.
Wavy hair is a very easy example that this is false. It's a merge between straight and curly hair. Our traits tend to mix and blend together, it's not so simple. Everybody isn't just tall or short, one or the other. Everybody is a different height because it's a mid between your parents.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Detrital<span> or clastic </span>sedimentary rocks<span> are composed of</span>rock<span> fragments. They are different than </span>chemical sedimentary rocks<span>, which are composed of mineral crystals. Learn how these </span>sedimentary rocks<span> differ in their formation and composition.</span>