1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
snow_lady [41]
3 years ago
12

List two Important things that a cell membrane does

Biology
1 answer:
Nana76 [90]3 years ago
3 0

Answer:

It controls what enters or leaves the cell, and is responsible for allowing nutrients in the cell.

You might be interested in
There are _____ levels of cell organization recognized by biologists.
BigorU [14]
There are five levels of cell organization recognized by biologists.
3 0
3 years ago
Read 2 more answers
The client reports to the nurse that she feels as if her eyes are persistently dry. this symptom is consistent with a deficiency
g100num [7]
The symptom that the client is experiencing is consistent with the deficiency in the Vitamin A which is a dietary element. The vitamin A is responsible for causing dryness to the eyes if a person is lacking this type of dietary element as Vitamin A is the one responsible for providing healthy vision for an individual.
7 0
3 years ago
Provide evidence to reject this statement, "Human phenotypes are usually a clear cut either situation"
tensa zangetsu [6.8K]
Wavy hair is a very easy example that this is false.  It's a merge between straight and curly hair.  Our traits tend to mix and blend together, it's not so simple.  Everybody isn't just tall or short, one or the other.  Everybody is a different height because it's a mid between your parents. 
8 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Compare and contrast detrital and chemical sedimentary rocks
Ilia_Sergeevich [38]
Detrital<span> or clastic </span>sedimentary rocks<span> are composed of</span>rock<span> fragments. They are different than </span>chemical sedimentary rocks<span>, which are composed of mineral crystals. Learn how these </span>sedimentary rocks<span> differ in their formation and composition.</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • What adaptations does this plant have to thrive in a dry, arid climate?
    6·2 answers
  • Hi! I really need this now and who ever does gets brainliest!
    12·2 answers
  • An antibiotic that attacks the LPS layer would be expected to have a broad spectrum of activity, effective against Gram negative
    8·1 answer
  • _refers to a procedure in which the fetus is delivered up to its head and the brain matter is removed A.chemical abortion B.pill
    13·2 answers
  • Usos de las bacterias en el campo de la medicina.
    15·1 answer
  • Scientific inquiry requires logical ideas that
    8·1 answer
  • N 1966, american biologist lynn margulis proposed the theory of endosymbiosis, or the idea that mitochondria are the descendants
    8·1 answer
  • Crossing over occurs in prophase of meiosis I. Crossing over results in A. half the number of original chromosomes. B. double th
    8·2 answers
  • Megan examines a liver cell and observes an organelle with many smooth-
    11·1 answer
  • Which of the following choices are the products of glycolysis?OOOOcarbon dioxide and wateroxygen and waterglucose2 pyruvate mole
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!