1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nadusha1986 [10]
3 years ago
10

What are tomatoes? fruit vegetables flowers roots?

Biology
2 answers:
Zigmanuir [339]3 years ago
7 0

The confusion about 'fruit' and 'vegetable' arises because of the differences in usage between scientists and cooks. Scientifically speaking, a tomato is definitely a fruit. True fruits are developed from the ovary in the base of the flower, and contain the seeds of the plant (though cultivated forms may be seedless). Blueberries, raspberries, and oranges are true fruits, and so are many kinds of nut. Some plants have a soft part which supports the seeds and is also called a 'fruit', though it is not developed from the ovary: the strawberry is an example.

As far as cooking is concerned, some things which are strictly fruits, such as tomatoes orbean pods, may be called 'vegetables' because they are used in savoury rather than sweet cooking. The term 'vegetable' is more generally used of other edible parts of plants, such as cabbage leaves, celery stalks, and potato tubers, which are not strictly the fruit of the plant from which they come. Occasionally the term 'fruit' may be used to refer to a part of a plant which is not a fruit, but which is used in sweet cooking: rhubarb, for example.

So, the answer to the question is that a tomato is technically the fruit of the tomato plant, but it's used as a vegetable in cooking.


Hope this helps :)

Norma-Jean [14]3 years ago
7 0

Answer:

Fruit.

Explanation:

Fruits can be defined as seed-veering structures of plants that develop from the ovaries of flowers, while vegetables are all other plant parts, such as stems and leaves.

As tomato is developed from ovary, having seeds of the plant, it is considered as a fruit.

Thus, the correct answer is option). Fruit.

You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
A glucose molecule is completely broken down to carbon dioxide and water in glycolysis and the citric acid cycle, but together t
Scilla [17]
It disappears from existence completely, idk. ask your teacher. hope this helps!
4 0
3 years ago
The nations of the world agreed to preserve Antarctica for
Archy [21]
D the expansion of their territory
4 0
3 years ago
Read 2 more answers
What hormone released by the highlighted structures inhibits the secretion of FSH only?
soldi70 [24.7K]

Inhibin inhibits the secretion of FSH only.

<h3>What is the role of inhibin?</h3>
  • Inhibin is a protein mainly produced by the gonads.
  • In men it is produced by the Sertoli cells and it is produced by the granulose cells in women.
  • It negatively regulates the secretion of Follicle Stimulating hormone (FSH) from the pituitary gland.
  • FSH itself induces the production of inhibin for negative feedback.
  • Pituitary is a pea shaped endocrine gland present at the base of the brain. It is the major endocrine gland and controls growth, development and functions of other endocrine glands.
  • Hormone activin has opposite effect to inhibin. It enhances FSH biosynthesis and secretion.

Learn more about pituitary here:

brainly.com/question/1372599

#SPJ4

5 0
2 years ago
Would transplantation a thymus from the wild type mouse into the sick mouse fix the ability of the sick mouse to fight infection
iogann1982 [59]
Balaba gorphness is your answer about mice
4 0
3 years ago
Other questions:
  • What happens during the lytic cycle?
    6·2 answers
  • Examine this food web for a particular terrestrial ecosystem which species is most likely a decomposer in this food web
    7·1 answer
  • Which statement best describes connective tissue? Which statement best describes connective tissue? usually contains a large amo
    11·1 answer
  • An animal body plan that is triploblastic and coelomate has ____ main layers of tissue during development, and a
    11·1 answer
  • The development of specific plant structures in particular locations is called pattern formation. Events in a plant's early deve
    6·1 answer
  • Which one of the following animals is a reptile​
    6·1 answer
  • List one way that mitosis and meiosis are similar<br> and 1 way they are different.
    15·1 answer
  • Select the correct statement about the three-chambered hearts of amphibians and nonbird reptiles. A scheme of blood circulation
    6·1 answer
  • What are 3 careers in environmental science​
    13·2 answers
  • Barbara is a research scientist at an organic pest control company. Part of her job is to find foods that ants will eat so the f
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!