1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AlexFokin [52]
4 years ago
8

What shapes does viruses come in?

Biology
2 answers:
Free_Kalibri [48]4 years ago
6 0

Answer:

In general, the shapes of viruses are classified into four groups: filamentous, isometric (or icosahedral), enveloped, and head and tail. Filamentous viruses are long and cylindrical. Many plant viruses are filamentous, including TMV (tobacco mosaic virus).

Explanation:

stealth61 [152]4 years ago
5 0

Answer:

Viruses comes in four different types of shapes such as Polyhedral, Sperical, Helical and Complex.

You might be interested in
True or False? An increase in the birth rate will tend to cause the population to grow at a faster rate. *
Diano4ka-milaya [45]
True an increase in birth rate will tend to cause the population
3 0
3 years ago
Read 2 more answers
Where do duplicated chromosomes line up during metaphase?
Mekhanik [1.2K]
During metaphase, the cell's chromosomes align themselves in the middle of the cell through a type of cellular "tug of war." The chromosomes, which have been replicated and remain joined at a central point called the centromere, are called sister chromatids.
6 0
3 years ago
Discuss the order in which seed dispersal mechanisms could have evolved
sladkih [1.3K]

The fossil records of primitive plants show a variety of seed dispersal mechanisms that has been adopted by plants at various stages and how they have evolved. The most primitive of this seed dispersal mechanism is the Anemochory

Anemochory is the dispersal of seed through the wind. The seeds have wing like structures and are lightweight to be able to fly away with the wind. They are dull colored and are pale that will prevent the seed from being visible.

Hydrochory is the next order of evolution of the seed dispersal mechanism which became majorly adopted by plants that tend to grow near water sources and those whose seeds are too heavy to fly in the air. One of the best examples is the coconut that falls off on the sea water in the coastal areas and floats to other lands and sprouts to a new plant.

Barochory is the dispersal of the seed through gravity. This is the mechanism where the fruit falls off to the ground due to gravity and grows into a new plant.

Endozochory is the dispersal of the seed through animals. In this case the seed is usually covered with a fleshy edible part which is consumed by the animals and in this process the seed goes into the digestive system of the animal and is excreted in a different place from where the seed can sprout into a new plant.

Ballochory is the dispersal of the seed due to the forceful ejection of the seed by explosive dehiscence of the seed. This lets the plant to place its seeds in a distant area. One of the best examples is the Hura Crepitans which is also called the dynamite tree, named after its exploding fruits.

6 0
3 years ago
Read 2 more answers
The relationship of structure and function is one of the major themes in biology. For the following tissue type, describe the st
Anestetic [448]
Simple cuboidal epithelium is a type of epithelium that consists of a single layer of cuboidal cells. These cuboidal cells have large, spherical and central nuclei. This type of tissue is found lining parts of organs and ducts in the body. its structure allows for absorption and diffusion in those areas. Mostly found in organs that are specialized  for secretion, such as salivary glands ( part of the digestive tract) and thyroid follicles, and those that are specialized for diffusion, such as the kidney tubules. 
6 0
3 years ago
What fossil evidence BEST supports the classification of animals into these two basic branches, still recognized today?
otez555 [7]
<span>evidence of exoskeletons and endoskeletons

</span>
8 0
3 years ago
Other questions:
  • The human population has grown exponentially due to all of the following factors except _____.
    9·2 answers
  • How does a Frog's integumentary system work with its respiratory system to maintain homeostasis
    6·2 answers
  • Why don't white tigers hibernate?
    14·2 answers
  • What does paramecium belong to in the 6 kingdoms?
    5·1 answer
  • What is the difference betweent animal and plant cells??
    13·1 answer
  • In the hardy weinberg equation shown below p is the frequency of the dominant allele and q is the recessive allele
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • If you wanted to study the effects of soil moisture and light intensity on the growth of soybeans and required a high ability to
    7·1 answer
  • Calluses or corns are the result of accelerated multiplication by:.
    13·1 answer
  • which pathogen causes toxic shock syndrome? group of answer choices vibrio cholerae staphylococcus aureus pseudomonas aeruginosa
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!