1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
3 years ago
13

How did improving treatment of patients with antibiotics lead to a new problem?

Biology
2 answers:
Alik [6]3 years ago
5 0
The new problem that arised after antibiotics was that the disease became immune to the antibiotics. So we had to make a better antibiotics that would fight this disease that was resistant to the old antibiotics.
Tcecarenko [31]3 years ago
3 0
Some bacteria became immune to antibiotics because of over use of the antibiotics. Therefore in the future antibiotics will no longer work because bacteria will become more and more immune to the point antibiotics will no longer work
You might be interested in
Generation of clonal diversity occurs primarily during which phase of life
iris [78.8K]

Fetal.

Hope this helps!


-Payshence

5 0
3 years ago
A teacher proposed that her class should consider using a jigsaw puzzle as a model of a scientific theory. The completed puzzle
Serga [27]
Answer: A) it doesn’t represent the way that some hypotheses might be rejected.

Explanation: Just helped someone answer this question.

Hope this helps ʕ•ᴥ•ʔ
4 0
3 years ago
Does succession ever stop?
denis-greek [22]

Answer:

Succession is not ever guaranteed to stop in any area due to the possibility of natural disasters, climate change, and disease. The climax within an area my exist for many years but the area always has the potential to be disrupted by unexpected events that may damage plant life.

Explanation:

7 0
3 years ago
Read 2 more answers
A baking tray is made of metal because it’s of heat. An oven mitt is used to take the tray out of the oven because it’s ______
prisoha [69]
An oven mitt is used to take the tray out of the oven because its insulated, or padded.
4 0
4 years ago
Read 2 more answers
What is the ONLY organ located in the region (umbilical)?
Vitek1552 [10]

Answer:

small intestine

Explanation:

Umbilical. The umbilical region contains the umbilicus (navel), and many parts of the small intestine, such as part of the duodenum, the jejunum, and the illeum. It also contains the transverse colon (the section between the ascending and descending colons) and the bottom portions of both the left and right kidney.

6 0
3 years ago
Other questions:
  • Antipsychotic drugs have proved helpful in the treatment of:
    9·1 answer
  • In a food web, a bird eats plant-eating insects but also eats berries, where does the bird fit in the food web?
    7·1 answer
  • Jenna says that an example of homeostasis is when body temperature is maintained at about 37° C. Allen says homeostasis is when
    12·1 answer
  • Why can carbon from very large molecules?​
    8·1 answer
  • Xylem _____.
    14·2 answers
  • Question 14 where would you expect to find an island arc system?
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Help plz
    8·1 answer
  • Which cell structure is correctly matched with its function?
    12·2 answers
  • DNA joins to another DNA molecule from which part of the DNA?<br>​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!