1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mrrafil [7]
3 years ago
15

TRUE OR FALSE: The rate at which a glacier moves is the same throughout the glacier.

Biology
1 answer:
inn [45]3 years ago
7 0
Check on google they will give you the answer and others descriptions
You might be interested in
Certain viruses, like HIV, actually contain RNA. When a virus of this type takes over a host cell, it makes DNA from its RNA. Th
vitfil [10]

Answer:

In viruses like HIV, the flow of information goes from RNA -> DNA -> RNA -> Protein, whereas the flow of information in all cells is DNA ->RNA -> Protein.

5 0
3 years ago
1. Which biome is thought to have the greatest variety of living things? A. Tundra B. Marine C. Grassland D. Rainforest​
Aleksandr [31]

Answer:

B. Marine

Explanation:

There are still things we don't know the ocean

5 0
3 years ago
Which of the following is true of a semiconservative model of replication?
zimovet [89]

Answer:

answer is the 1st option (A)

7 0
3 years ago
Read 2 more answers
the volume of a human brain is normally about 1200cm3. the osmolarity of solutes in the cerebrospinal fluid surrounding the brai
qwelly [4]

Answer:

yesterday was a temporary password is goes by

8 0
3 years ago
Magnesium deposits are most likely to form from:
bagirrra123 [75]

Answer:

precipitation

sorry I'm not sure how to explain that

3 0
3 years ago
Other questions:
  • Which best defines homeostasis? 
    15·2 answers
  • Which of the following statements is FALSE?
    10·2 answers
  • Based on fossil evidence, about how long ago did the first
    14·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • AlAn
    14·1 answer
  • Both Gregor Mendel and Alfred Wegener proposed ideas that were not accepted completely by the scientific community during their
    14·2 answers
  • An organism which must obtain its food from other organisms is called
    11·1 answer
  • How does the environment affect phenotype in general?
    9·1 answer
  • An animal is born with albinism (lack of pigmentation). This is an example of which of the
    12·1 answer
  • As a control for your sasquatch experiment, you place a fake deer in the forest. The role of this control in your experiment is
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!