In respect to the foundations of prejudice social identity theory is associated with the concept of

Biology

2 answers:

jekas [21]3 years ago

6 0

Answer:

Cognitive thinking of social standing

Explanation:

Social identity theory has three key cognitive components

a) social categorization

b) social identification

c) social comparison

All individuals on this planet try to maintain a positive or favorable social image in order to create a favorable position for themselves with in the society.

The social identity theory promotes social behaviour that is determined by the character and motivations of the person as well as by the group to which it belong.

den301095 [7]3 years ago

5 0

Racism is one of the leading causes of social identity based on and associated with the foundations of prejudice.

You might be interested in

Which factor below would be least likely to cause a mutation in the cells of an organism.

USPshnik [31]

A) A sound wave

The other 3 create mutations, are cells are hit by sound waves all the time and experience no mutations because of it

3 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Even in a fully grown adult, cell still undergo cell division why is this useful

irakobra [83]

Think about skin cells. Skin cells shed every day, if cell division didn't take place, you would just constantly be losing skin cells.

3 0

3 years ago

Please help me this is science

-BARSIC- [3]

Answer:

Orgams

Explanation:

Organs

8 0

3 years ago

What is periderm and protoderm and where do they originate from in a new plant ?

Sati [7]

Periderm is the corky outer layer of a plant stem which the plant creates as a result of an injury or infection so as to protect itself further. Protoderm is the thin layer which covers embryos, as well as the root and stems, and later produces epidermis, which is the outer layer of tissue of plants (anywhere where periderm doesn't cover them).

7 0

3 years ago