1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodka [1.7K]
4 years ago
6

Brian wants to buy a mare which he can breed to help develop a horse-breeding operation. Larson offers to sell Brian a horse whi

ch he believes is healthy, and should make a good broodmare when a little older. After two years, the horse has not yet foaled. The veterinarian tells Brian that the horse is incapable of breeding. If Brian sues to rescind the contract with Larson, it is:
Biology
1 answer:
IRISSAK [1]4 years ago
8 0
<h2>Horse breeding Operation</h2>

Explanation:

  • Brian was not aware of that fact that the horse is incapable of breeding at the point he buys it, but Larson assures Brian the horse is healthy. In this light, if Brian sues to cancel the contract with Larson, the court will allow it based on a mistake of fact. This way the court will reduce any civil liability or criminal culpability because Larson might not know that the horse cannot breed, although he is certain that the horse is healthy
  • Hence, the right answer is "Likely that a court will allow the rescission based on a mistake of fact"

You might be interested in
Rhodobacter cells perform photosynthesis in the presence of light and grow heterotrophically in the dark. After being cultured i
Marrrta [24]

Answer:

Phenotypic changes:

When Rhodobacter is cultured in total darkness for multiple generations, the ability to produce it's own photopigment reduces with time with little or no ability to undergo its own photosynthesis due to absence of enzymes or pigment for photosynthesis.

It becomes expensive for the Rhodobacter to undergo photosynthesis. This allows mutants that can grow in the dark to take over from the culture grown in the dark.

Evolutionary processes:

It's natural selection that allows the fittest organism to survive. As in the case of the mutants

5 0
4 years ago
What will happen to the universe billions of years from now?
lorasvet [3.4K]
There's no any exact scientific results and nobody currently know what will exactly happen, but some scientists suggested that the sun might expand and dies that leads to the end of the world but some says there will be a new sun being born and like that.
7 0
4 years ago
Read 2 more answers
Research has found that the body's immune system can attack your own body parts, leading to all but which of the following condi
lapo4ka [179]
Pretty sure it diabetes...
3 0
3 years ago
Read 2 more answers
The disease cystic fibrosis (CF) is caused by a mutation to the CFTR gene which affects the respiratory, endocrine, reproductive
Lady bird [3.3K]

Answer: DF508 mutation. A Genetic, Hereditary, Autosomal and Recessive Mutation.

Explanation:

Cystic fibrosis (CF) is a recessive autosomal lethal disease, it is most common on Caucasoid populations. Its diagnosis is suggested by the clinical features of chronic obstructive pulmonary disease, persistent pulmonary colonization (particularly with mucoid Pseudomonas strains), meconium ileus, pancreatic insufficiency with or familiarity history of the disease. The FC gene is large, with about 250 Kb of genomic DNA, 27 exons representing about 5% of genomic DNA; encodes a 6.5 kb transcribed mRNA. This mRNA is transcribed into a protein of 1480 amino acid called CFTR (Regulator Transmembrane Conductance Cystic Fibrosis). When a three-base pair deletion, adenosine-thymine-thymine (ATT) identified in the CFTR gene, exon 10, it results in the loss of a single amino acid phenylalanine at position 508 of the protein. This mutation is called DF508; “D” stands for deletion and “F” for phenylalanine amino acid.

4 0
3 years ago
In an ecosystem can there be more carnivores than herbivore? Explain why or why not
Kobotan [32]
There cannot be more carnivores than herbivores because the carnivores eat the herbivores. If there wasn't enough herbivores to eat, then the carnivores would eventually become extinct.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Refusing to follow the prescribed treatment regimen, a client plans to leave the hospital against medical advice. what is it imp
    9·1 answer
  • When analyzing a text for the SOAPS element of "occasion", which two aspects should be considered?
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which statement correctly describes the process that occurs in the thylakoid?
    15·1 answer
  • Some single-celled organisms make copies of themselves through mitosis. Which decribes the function of the cell cycle in such si
    15·1 answer
  • How would Darwin’s explanation of long necks in giraffes differ from Jean Baptiste Lamarck’s explanation of the same trait?
    5·1 answer
  • Which changes the litmus paper to red
    5·1 answer
  • The chemical that moves from the axon of one neuron across a gap to the dendrite of
    12·1 answer
  • What type of pollination creates hybrids?
    14·1 answer
  • Explain they transitional fossils provide powerful evidence for common descent
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!