1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vladimir79 [104]
3 years ago
7

For most women, the American Academy of Pediatrics recommends exclusive breast-feeding for the first 6 months of the baby’s life

. What are the benefits of breast-feeding?Please choose the correct statements about breast-feeding.Select all that apply.1- Infants receive colostrum via breast milk during the first 6 months of breast-feeding.2- Breast-feeding is typically less expensive than formula feeding.3- Breast-feeding can reduce an infant’s risk of infection, allergies, and certain chronic diseases.4- All mothers should consume 500 kcal extra daily while breast-feeding until weaning of the infant.5- Women with AIDS or active tuberculosis should feed formula rather than breast-feed.
Biology
1 answer:
Naily [24]3 years ago
8 0

Answer:

3- Breast-feeding can reduce an infant’s risk of infection, allergies, and certain chronic diseases.

.4- All mothers should consume 500 kcal extra daily while breast-feeding until weaning of the infant.

5- Women with AIDS or active tuberculosis should feed formula rather than breast-feed.

Explanation:

Breastfeeding is also a great benefit to the environment and society, that is, it does not require the use of energy for manufacturing or create waste or air pollution. Also, there is no risk of contamination and it is always at the right temperature and ready to feed. Given the importance of breastfeeding for the health of mothers and babies, Centers for Disease Control and prevention supports breastfeeding through hospital initiatives, work-site accommodation, continuity of care and community support initiatives. Colostrum is the earliest breast-milk produced, beginning in mid-pregnancy (12-18 weeks) and is continually produced for the first few days after baby's birth, it provides all the nutrients and fluid that your newborn needs in the early days, as well as many substances to protect your baby against infections.  Mothers with untreated and active tuberculosis infections are not advised to breastfeed. They may breastfeed after their infection is cured or brought under control so that it does not spread to the infant.

You might be interested in
Organisms of the same species that can reproduce to make more of that species are called
vfiekz [6]

Answer: Species/Organism

QUICK DISCLAIMER: "I previously said Populations but my answer was reported and removed Imao. Honestly, if someone gives you a wrong answer, don't blame them, blame yourself for not doing it on your own. Keep that in mind."

7 0
3 years ago
Which of the following is a correct association?
Neporo4naja [7]

Answer:

The first one

Explanation:

because it has the most words on their.

8 0
2 years ago
The most prominent type of intraregional migration in the world i
Mice21 [21]
It is RURAL to URBAN areas.
4 0
3 years ago
Which malfunctioning organelle within the cell can cause conditions ​
SSSSS [86.1K]
There's a malfunction in the tiny capsule-shaped structures—called mitochondria—that power his cells. These abnormal mitochondria cause extreme fatigue and weakness in his legs, trouble breathing and a host of other problems.
6 0
3 years ago
Which best describes a fossil that helps determine the relative age of a rock layer?.
Galina-37 [17]

Answer:

by how deep they are

Explanation:

the deeper the fossil the older it is

7 0
2 years ago
Other questions:
  • Select all that apply
    12·1 answer
  • Biosphere II is a self-contained ecological system that was sealed with researchers inside. Unfortunately, the microbes in the s
    7·1 answer
  • Antonio is holding a 1-pound bag of apples in his left hand and a 2-pound bag of apples in his right hand. Which sentences about
    7·2 answers
  • A mating between a male donkey (2n = 62) and a female horse (2n = 64) produces sterile mules. why are mules sterile?
    8·1 answer
  • Deep-oceanic trenches are formed a subduction
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Discuss why prenatal care is so important.
    11·2 answers
  • The diagrams show a partial food web containing the Glyptapanteles wasp and the life
    15·2 answers
  • Questions about natural selection
    9·1 answer
  • Give an example of a species that has been introduced to the United States and tell what its effect has been
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!