During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
C the decrease in body temperature
<h2>The answer would be
A.</h2>
When there are <em>multiple convection cells in each hemisphere</em>, something called <u>"The Coriolis effect"</u> happens. The defination is basically that the Earth rotates perpendicular to it's axis which is answer A.
Hope this helps!
I used it on my test and it was right.
Birds, unlike mammals, do not have separate exits for urine and feces. Both waste products are eliminated simultaneously through the cloaca. While mammals excrete nitrogenous wastes mostly in the form of urea, birds convert it to uric acid or guanine, which reduces water loss in comparison.
