1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
4 years ago
12

What molecule most likely has the greatest amount of stored energy in its bonds?

Biology
2 answers:
tia_tia [17]4 years ago
5 0

Answer: ATP

Explanation:

Adenosine tri phosphate is the molecule having the maximum amount of energy in it. This is a high energy molecule which is used as a energy source for various types of metabolic reactions taking place inside the body of an organism.

During the process of cellular respiration the energy from the carbohydrates are broken down and the energy is stored in the form of ATP.

Hence, the answer is Adenosine triphosphate.

Misha Larkins [42]4 years ago
4 0
ATP- Adenosine triphosphate

You might be interested in
Forest decline, like this, is a new phenomenon that is directly related to the activities of man on Earth. High altitude defolia
lapo4ka [179]
The Answer is. B: Acidic clouds.
6 0
3 years ago
Read 2 more answers
What molecule helps to ensure that dna replication is accurate?
lina2011 [118]
The answer is DNA polymerases


Hope I helped... Sorry if I didnt
5 0
4 years ago
Give three reason why specialized systems are necessary in large multicellular organisms
kotykmax [81]

Answer:

Specialized systems are necessary in large multicellular organisms since 1. there is a division of labor between cells, 2. many individual cells cannot work together without coordination, and 3. most of the cells are not in direct contact with the outside environment

hope it helps

pls mark me as brainliest

8 0
3 years ago
Read 2 more answers
In Wisconsin a very large population of lake trout in which individuals mate at random experiences no migration mutation nor sel
VLD [36.1K]
<span>In this population, what will occur is that there will be no evolution. Mutation is neccessary and important because they provide varitations that can result in evolutionary change. Other factors needed for evolution to occur are migration and selective pressure.</span>
7 0
3 years ago
How does oxygen enter the cells of the tube worm
const2013 [10]

Answer:

Flatworms are small, literally flat worms, which 'breathe' through diffusion across the outer membrane (Figure 2). The flat shape of these organisms increases the surface area for diffusion, ensuring that each cell within the body is close to the outer membrane surface and has access to oxygen.

Explanation:

Hope this helps!

8 0
3 years ago
Read 2 more answers
Other questions:
  • PLEASE HELP! ILL GIVE YOU A MEDAL AND FAN YOU!
    15·1 answer
  • Which is an electromagnetic wave
    11·1 answer
  • In the plate tectonics theory, the lithosphere is divided into ____.
    10·2 answers
  • Among other functions, hepatocytes (liver cells are specialized for detoxifying drugs or other chemicals. hepatocytes have large
    5·2 answers
  • How can looking for signal words help you take better notes
    6·1 answer
  • CLASSIFY: Is solar energy an ecosystem service? Why or why not?<br><br> Please Explain.
    9·1 answer
  • The brain communicates with the rest of the body through the ____.
    8·2 answers
  • DNA replication results in two DNA molecules, _________________________. Thus replication is _________________________.
    10·1 answer
  • What molecule is active first in DNA replication
    14·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!