Because organisms at different tropic levels get their energy from the organisms at the lower tropic levels.
Answer:
Ozone (O3)
Nitrogen Oxides (NOx)
Carbon Monoxide (CO)
Sulfur Dioxide (SO2)
Particulate Matter (PM10 and PM2.5)
Explanation:
The length of interphase (phases of mitotic division of a cell) can vary from organism to organism and cell to cell.
Interphase includes a few stages:
G1: this is the longest phase of the cycle. It follows the mitotic division, and is the part where new cells have the chance to start to growing. Proteins are created by the cell so that DNA can be replicated. Usually takes about 10 hours.
S: the length of this phase is unique to the quantity of DNA in that specific cell. This is where chromosomes and DNA are replicated and doubled. It usually takes between 5 and 6 hours to complete.
G2: this phase includes the first stage of mitosis. This is where most of the proteins needed for mitosis are created. It's the shortest of the three and usually takes between 3-4 hours.
So in total, the entire interphase will last anywhere from 18-20 hours.
Answer:
ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC
Explanation:
Splicing is the process of modification of primary transcript and occurs after the process of transcription. During splicing, intervening non-coding nucleotide sequences called introns are removed. The exons are joined together to make a mature mRNA whose nucleotide sequence would code for protein. The introns (in lower case letters) will be removed from the given sequence of primary transcript during splicing.
Primary transcript: ACAAACUAGAUGGUACgugacagatacagaguagugaaguagCAGAUAAUAUAUAGGCC
After splicing: ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC
