In a cell protein synthesis is the primary function of ribosomes
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
<em>There are two types of vascular tissues witch are Xylem and Phloem</em>.
<em>Xylem is for water transport.</em>
<em>Phloem is for glucose.</em>
<em>Here is an extra just for you! ;)</em>
<em>Parenchyma for lateral transport of both. </em>
<span>Surface currents are generated largely by wind. Their patterns are determined by wind direction, Coriolis forces from the Earth’s rotation, and the position of landforms that interact with the currents. Surface wind-driven currents generate upwelling currents in conjunction with landforms, creating deepwater currents. </span>
Answer:
If we're talking about human organism then
It is multicelular.
It has a backbone.
It contains cells without nuclei.
Explanation:
human as almost all animals in the world is multicellular meaning they have more than one cell (some bacterias has only one)
backbone or "vertebra" is the is the bone of our back who supports us making us stand up.
Yes our cells contain nuclei
, The nucleus contains nucleoplasm, a component where it is immersed in genetic material and as structures that are important for the performance of its functions
And finally our body don't have radial symmetry, radial symmetry is when you can "cut" the image in more than one piece keeping the symmetry in every side, some animals with radial symmetry are the starfish and the jellyfish.
