1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mamaluj [8]
2 years ago
13

Water's high heat of vaporization allows it to cool us off when we sweat. True False

Biology
1 answer:
SCORPION-xisa [38]2 years ago
4 0
False.

You’re body uses sweat to cool off in high temperatures. I don’t think vaporization has anything to go with it. Also, the water wouldn’t be hot since you’re cooling off by using it.
You might be interested in
PLEASE HURRY
Luda [366]

Answer:

Venus should be b

good luck

Explanation

the order is Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune

6 0
2 years ago
Read 2 more answers
Explain how the taiga is different from the other forest ecosystems.
serg [7]

Taiga is a winter type forest. Taiga is different then other ecosystems because other ecosystems are not has cold has Taiga. Taiga ecosystems can get has low has -70 °F (or -60° C)

But Taiga ecosystems can get has hot has 104°F (or 40°C)

Taiga ecosystems can get colder then tundra (which is another very cold too)

Some things that make the Taiga ecosystems unique is:

  1. Evergreen trees, the Taiga is COVERED with these.

Hope this helps!

Any extra info can be provided!

-Nat

Brainliest?

3 0
2 years ago
Briefly explain how the genetic code is analogous to the letters of the alphabet
krek1111 [17]

Genetic code is a sequence of 3 letter word, known to be one after the another along the length of the DNA.

3 0
3 years ago
Many communities in Virginia benefit from watershed protection programs.
RUDIKE [14]

Answer:2. Flooding and 4 run off

Explanation:Watershed areas are prone to flooding. They also cause a lot of runoff

5 0
3 years ago
What is the meaning of earthquake? ​
Furkat [3]
A sudden and violent movement of the ground sometimes causing great destruction as a result of movements within the earths crust or volcanic action.
5 0
2 years ago
Other questions:
  • Suggest two reasons for using cladograms for the classification of organisms
    10·1 answer
  • What element is the sun made of
    15·1 answer
  • Which of the following molecular motors is associated with intermediate filaments?
    15·1 answer
  • Why does there tend to be more life in the upper portions of aquatic<br> ecosystems?
    12·1 answer
  • Heat is most closely related to _____<br> energy.
    11·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Saprophytic (something that lives on dead and decaying material) fungi are essential to life on Earth because they: Group of ans
    7·1 answer
  • What are two ways in which the value of soil can be reduced?
    9·1 answer
  • What happens during prophase?
    7·2 answers
  • June was upset to find one day that her bonsai was covered in ants and as a result, was worried for the health of her award-winn
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!