1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
charle [14.2K]
4 years ago
5

This graph shows that bird ranges in the winter have been shifting northward over several decades

Biology
2 answers:
horsena [70]4 years ago
7 0
The first box is migration
The second box is the northern regions have become warmer because of climate change 
german4 years ago
5 0

Answer:

The first box is migration

The second box is the northern regions have become warmer because of climate change

Explanation:

You might be interested in
True or false? investigators trying to track the early spread of hiv found hiv-infected blood samples from as early as 1956, in
Anastasy [175]
False  
The diseases, announced by Dr. Stig Froland, Dr. Paul Jenum and associates, shows that AIDS happened in disengaged occasions far and wide some time before general wellbeing authorities saw it years back.   
In the Norwegian case, a mariner conceived in 1946, was first observed by Dr. Froland in 1966. He experienced general swelling of the lymph organs, respiratory diseases and different other health issues. Both his wife and child has complications as well from the ailment and all members of the family passed on in 1976.
3 0
4 years ago
An ___ ___ is observed due to the unequal transport of charge by a transport mechanism that occurs across a plasma membrane.
insens350 [35]

Answer:

An electrogenic effect

Explanation:

An electrogenic transport is a process where there is a translocation of net charge across the membrane. E.g of electrogenic channels are Na+, K+, Ca2+, and Cl− channels.

7 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
____ is the natural process by which water is continually recycling between the Earth's atmosphere,
Sveta_85 [38]

Answer:

Option D

ans : water cycle

5 0
3 years ago
Read 2 more answers
What is the term used to descibe the build -up of a higher concentration of H + on one side of the inner membrane of the mitocho
shepuryov [24]

Answer:

espanhis plis plisplisplisplis

6 0
3 years ago
Other questions:
  • Imagine what it would be like to live in the enclosed space of the ISS. What do you think would personally be the biggest
    10·1 answer
  • The net result of a single glycolysis run is the formation of
    6·1 answer
  • How do the nucleotides in DNA pair ?????
    13·2 answers
  • There are two different alleles for flower color, P and p. The image shows a white sweet pea that is labeled with its two allele
    9·1 answer
  • Type i alveolar cells secrete pulmonary surfactant. <br> a. True <br> b. False
    6·1 answer
  • What is the list of organelles that take part in protein synthesis
    6·1 answer
  • First set of offspring in an experiment​
    10·1 answer
  • Do buffalo compete for food with other herbivores? If so, for what food and when?
    12·2 answers
  • Help me PLEASEE!!! IT will mean alot
    15·2 answers
  • The roots of the plant in the diagram above are exhibiting which behavior?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!