1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hjlf
3 years ago
14

WILL MARK BRAINLIEST HELP PLEASEEE

Biology
2 answers:
Tanzania [10]3 years ago
8 0

1. Which limiting factor(s) in this lab simulation are biotic?


Limiting factor is resource/condition that could limit the growth or the population of an organism in the ecosystem. Some factor could be deleterious(like predator) and reduce the population while other could be advantageous(like food) and increase the population. The biotic factor consist of living things.

The biotic factor in this simulation would be alligator and the mosquito.

2. Which limiting factor(s) in this lab simulation are abiotic?


Abiotic factor  consist of nonliving things. The non-living factor in this scenario would be the pollution. Increased pollution could damage all the biotic factor and might limit them. The damage might not be equal as some organism could be more sensitive to the pollution than the other.

3. Which limiting factor impacted the cricket frog population the most? Use evidence to support your answer.



I would say that the predator/alligator is limiting factor that impacted the cricket frog population the most. If you compare the condition of simulation 1 and simulation 2, alligator population is the one that undergo highest change. The population increased by 40,000 in simulation 1 and decreased by 35,000 in simulation 2.


4. Which limiting factor impacted the cricket frog population the least? Use evidence to support your answer.



I think the pollution is the limiting factor impacted the cricket frog population the least. The changes of the pollution number is least when compared to other factor. It doesn't change in simulation 1. The pollution decreased by 15,000 in simulation 2 while the alligator decreased by 35,000 and the mosquito increased by 35,000


5. Mosquitoes can carry and transmit disease to animals and humans. Explain how the cricket frog plays an important role in limiting the spread of mosquito-borne illnesses like West Nile virus and malaria.


The frog predate the mosquito, so the population of frog will decrease the population of the mosquito. The mosquito borne illness is transmitted by the mosquito that contact the pathogens. If the population of mosquito decreased, there will be less mosquito that contact the pathogens. There will be less mosquito that transmit the disease too.

6. Predict the long-term effects of these limiting factors on the cricket frog population in the pond ecosystem.


Increase in predator population will decrease the population of food, and if the food start to decline the predator population will be decreased. Their interaction will prevent the population of one factor to become too big.

In long term, these factors will achieve a stable range. Unless there is a new limiting factor that cause changes in their interaction, the population should be kept at the stable range.

cestrela7 [59]3 years ago
5 0

Answer:

Which limiting factor(s) in this lab simulation are biotic?

The biotic limiting factors are the alligators and mosquitoes.

Which limiting factor(s) in this lab simulation are abiotic?

The abiotic factor is the pollution.

Which limiting factor impacted the cricket frog population the most? Use evidence to support your answer.

 The predator/alligator is the limiting factor that impacted the cricket frog population the most, because in the simulation it left the least amount of cricket frogs.

Which limiting factor impacted the cricket frog population the least? Use evidence to support your answer.

It would be pollution, because it left more frogs than the predator/alligator did.

Mosquitoes can carry and transmit disease to animals and humans. Explain how the cricket frog plays an important role in limiting the spread of mosquito-borne illnesses like West Nile virus and malaria.

The cricket frog plays an important role, because the more cricket frogs there are the less mosquitoes, which can help stop them from giving illnesses.  

Predict the long-term effects of these limiting factors on the cricket frog population in the pond ecosystem.

If there was an increase in predator population will decrease the population of food, when the food starts to decline the predator population will decrease.

In the long term, the factors will achieve a stable range, unless there is a new limiting factor

You might be interested in
Pls help me with this and pls stop missing around with this else l report
Gelneren [198K]

Answer:

a. an organism that has two different alleles for a trait

b. possible genotypes for the offspring

Credit goes completely to: Unknown Quizlet user

I hope this helps!

5 0
3 years ago
Read 2 more answers
Which of the following is a correct statement about sugar movemetn in phloem?
Simora [160]

Answer:

a. movement can occur both upward and downward in the plant

Explanation:

The phloem loading causes the accumulation of sugars in the sieved elements generating a negative solute potential (quedas), with a drop in water potential (ψw), so water enters the sieved elements increasing the turgor pressure (ψp). With the discharge of phloem in the drain occurs lower concentration of sugars in the screened elements, increases the solute potential, becoming positive, thus the phloem water potential increases and thus the water leaves the conducting vessel. In the specific case of sugar movement in the phloem, it can be stated that this movement can occur both up and down in the plant.

7 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Peter, who lived 200 years ago, had a house with no rats in it. One day, his wife
antiseptic1488 [7]

Answer:

1 is always rifht

Explanation:

i think so

6 0
3 years ago
How does life exist at the bottom of the
Mekhanik [1.2K]

Answer:

C. Organisms are capable of producing food without light.

Explanation:

this is the best answer because mostly bacteria live in the the bottom of the ocean. and they feed on dead organisms who have already harnessed the sun's light to create food.

4 0
3 years ago
Other questions:
  • How is mass spectrometry used for protein-protein interaction?
    9·2 answers
  • Multicellular organisms have five levels of organization ranging from simplest to most complex. The simplest level is the cellul
    14·2 answers
  • 1. In pea plants, round seeds (R) are
    15·1 answer
  • Greg has been given a small sample of metal. His teacher has assigned him to identify what type of metal he was given.
    12·1 answer
  • The lactose analog isopropyl-b-D-thio-galactoside (IPTG) is often used to regulate gene expression systems in bacteria. IPTG doe
    7·1 answer
  • When a single cell undergoes mitosis, what is the result?
    15·2 answers
  • I am unpredictable as I change myself in a short time span.
    14·1 answer
  • Contrast growth in living and nonliving things
    5·1 answer
  • Important advantages to raised-bed gardens are that they
    7·1 answer
  • An alternative to a controlled experiment would be a(n). a.. quantitative study. b.. correlation study. c.. field study. d.. a l
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!