1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zubka84 [21]
4 years ago
15

Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG

Biology
1 answer:
k0ka [10]4 years ago
7 0

Answer:

TTAACGCTAGCGAGCATGGCC

Explanation:

A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.

You might be interested in
Suppose the phloem of a seed plant is damaged and does not function properly.
Kisachek [45]

Answer:The might likely die.

Explanation:

Phloem and xylem tissues are the major conducting tissues in plant. Xylem conduct ( transports) water and minerals salts from the soil through the roots to all parts of the plant while phloem conducts manufactured food from the leaves to other parts of the plant.

Now, if the phloem of a seed plant is damaged and not functioning well, the manufactured food will not get to other parts of the plant where it is needed or supposed to be stored.

If the plant is no longer getting these nutrients, its growth and development will be affected. It might lead to the death of the plant.

3 0
4 years ago
How are hormones stored and secreted? summarize them.​
Softa [21]

Answer: The hormones are stored in the Endocrine System and secreted in the blood.

Explanation: The Hormones are ductless, they do not have ducts. So the hormones are secreted in the blood. The endocrine system has glands which produces one or more hormones. Thus the hormones are stored in the Endocrine System.

3 0
3 years ago
You looking for the answer aint you ? welp its not here...go watch icarly ❤️
Rom4ik [11]
But I don’t want to watch ICarly.
7 0
3 years ago
Read 2 more answers
What is the relationship between heat and change of state
Anettt [7]
When you apply heat with a certain temperature on a substance, it may change state.
For example, pure water boils at 100°C, water changes from liquid to gas, that's a change of state, it only happens if the heat u applied is over or at 100°C.
3 0
4 years ago
An atom consist of an atomic nucleus composed of positvely charged
alex41 [277]
An atom consists of an atomic nucleus composed of positively charged protons and neutral or uncharged neutrons.
7 0
4 years ago
Other questions:
  • What two terms are used for an organism’s binomial name
    10·1 answer
  • What are three heat sources for metamorphism?
    5·2 answers
  • Due to its system of air sacs connected to the lungs, the respiratory system of birds is arguably the most effective respiratory
    5·1 answer
  • You observe a uniform tissue under a microscope. There is no lumen. The material looks densely packed, but you do not observe ma
    6·1 answer
  • The layers of the atmosphere are classified according to changes in
    9·1 answer
  • What part of the sun is about 15 million C
    12·1 answer
  • Charicteristics of the thermosphere
    15·1 answer
  • What type of cells<br> would producers<br> contain? List 3<br> examples.
    5·2 answers
  • How does air flow when a low-pressure center occurs in the atmosphere?
    10·1 answer
  • What is the product made in the Calvin Cycle?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!