1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zubka84 [21]
4 years ago
15

Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG

Biology
1 answer:
k0ka [10]4 years ago
7 0

Answer:

TTAACGCTAGCGAGCATGGCC

Explanation:

A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.

You might be interested in
1.what are the characteristics of bacteria
qwelly [4]
#1: Bacteria are like eukaryotic cells in that they have cytoplasm, ribosomes, and a plasma membrane. Features that distinguish a bacterial cell from a eukaryotic cell include the circular DNA of the nucleoid, the lack of membrane-bound organelles, the cell wall of peptidoglycan, and flagella. #2: Archaea have more complex RNA polymerases than Bacteria, similar to Eucarya. Unlike bacteria, archaea cell walls do not contain peptidoglycan. Archaea have different membrane lipid bonding from bacteria and eukarya. There are genetic differences. #10: Bacteria are classified into 5 groups according to their basic shapes: spherical (cocci), rod (bacilli), spiral (spirilla), comma (vibrios) or corkscrew (spirochaetes). They can exist as single cells, in pairs, chains or clusters. #12: Bacteria reproduce .In this process the bacterium, which is a single cell, divides into two identical daughter cells. Binary fission begins when the DNA of the bacterium divides into two (replicates). Each daughter cell is a clone of the parent cell. #13: Pathogenic bacteria are bacteria that can cause disease. ... One of the bacterial diseases with the highest disease burden is tuberculosis, caused by the bacterium Mycobacterium tuberculosis, which kills about 2 million people a year, mostly in sub-Saharan Africa. Infection with a pathogen does not necessarily lead to disease. Infection occurs when viruses, bacteria, or other microbes enter your body and begin to multiply.Pathogenic microbes challenge the immune system in many ways. Viruses make us sick by killing cells or disrupting cell function. #14: Antibiotics work by affecting things that bacterial cells have but human cells don't. For example, human cells do not have cell walls, while many types of bacteria do. The antibiotic penicillin works by keeping a bacterium from building a cell wall. HOPE I HELPED I Don’t NO #11
6 0
3 years ago
DNA is often compared to a twisted ladder. In this analogy, what forms the
Oxana [17]
A- on the sides you would find the phosphate and sugar so the center is the AT or CG
5 0
3 years ago
What job does each organelle do in a cell?
erica [24]
I hope that it is correct

6 0
4 years ago
A capsule stain is described as a negative stain because the capsule itself __________. does not take up stain has a negative ch
KonstantinChe [14]

Answer:

Does not take up the stain.

Explanation:

Negative staining refers to the process wherein the unstained specimen is visualized under the darkly stained background.

One of the examples is capsule staining wherein the capsulated cells are stained with India ink or nigrosin dyes. The particles of these dyes stain the background blue-black but cannot enter the capsule.

Hence, the light-colored capsulated cells are visualized in the midst of the blue-black background.

6 0
3 years ago
How can the body of an animal stay healthy
Brrunno [24]
The answer is D). Fighting disease

4 0
3 years ago
Read 2 more answers
Other questions:
  • Biomes are large regions characterized by certain conditions, including a range of climate and ecological communities adapted to
    11·1 answer
  • How does a graph make it easier to analyze data?
    13·2 answers
  • What are the main differences between living cells and viruses
    12·2 answers
  • A normal strand of DNA is shown below, followed by the same strand of DNA after mutations have occurred. Identify the mutation a
    5·2 answers
  • ryan loves taco bell and frequently eats there during the week. he is not very physically active and has noticed that he has gai
    13·2 answers
  • Four Reasons why having environmental personal mission statement may enhance the environment? ​
    13·1 answer
  • I hope you can help me <3
    15·2 answers
  • Please ans this question.
    7·1 answer
  • There are two types of reproduction, sexual and asexual Sexual reproduction involves two parents, while asexual reproduction onl
    11·1 answer
  • 1) The human population is currently over 7 billion and is continuing to grow. Which of these is a benefit of a growing
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!